ID: 1090803879

View in Genome Browser
Species Human (GRCh38)
Location 11:130190535-130190557
Sequence CCGCTCATGCCCGCTGCCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090803868_1090803879 7 Left 1090803868 11:130190505-130190527 CCACGCCCGGCTTCCCTGACAGC 0: 1
1: 0
2: 2
3: 21
4: 271
Right 1090803879 11:130190535-130190557 CCGCTCATGCCCGCTGCCAGTGG 0: 1
1: 0
2: 1
3: 4
4: 77
1090803870_1090803879 1 Left 1090803870 11:130190511-130190533 CCGGCTTCCCTGACAGCCCCTAC 0: 1
1: 0
2: 4
3: 31
4: 350
Right 1090803879 11:130190535-130190557 CCGCTCATGCCCGCTGCCAGTGG 0: 1
1: 0
2: 1
3: 4
4: 77
1090803869_1090803879 2 Left 1090803869 11:130190510-130190532 CCCGGCTTCCCTGACAGCCCCTA 0: 1
1: 0
2: 1
3: 33
4: 318
Right 1090803879 11:130190535-130190557 CCGCTCATGCCCGCTGCCAGTGG 0: 1
1: 0
2: 1
3: 4
4: 77
1090803872_1090803879 -7 Left 1090803872 11:130190519-130190541 CCTGACAGCCCCTACCCCGCTCA 0: 1
1: 0
2: 3
3: 10
4: 227
Right 1090803879 11:130190535-130190557 CCGCTCATGCCCGCTGCCAGTGG 0: 1
1: 0
2: 1
3: 4
4: 77
1090803871_1090803879 -6 Left 1090803871 11:130190518-130190540 CCCTGACAGCCCCTACCCCGCTC 0: 1
1: 0
2: 0
3: 16
4: 261
Right 1090803879 11:130190535-130190557 CCGCTCATGCCCGCTGCCAGTGG 0: 1
1: 0
2: 1
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090803879 Original CRISPR CCGCTCATGCCCGCTGCCAG TGG Exonic
902818086 1:18927389-18927411 CCCCACCTGCCCTCTGCCAGAGG - Intronic
905643673 1:39609786-39609808 CCGCTCCTCCCGGCCGCCAGAGG - Intergenic
909012899 1:70354401-70354423 CCGGTCATCGCCGCCGCCAGGGG + Exonic
919548166 1:198949504-198949526 CGCCTCATCCCCGCTCCCAGGGG + Intergenic
1063138765 10:3238758-3238780 CCTCTTATTCCCGCTGCCACAGG - Intergenic
1072700967 10:97641023-97641045 CCGCTCAGGCCCACCGCGAGCGG + Exonic
1073118704 10:101108276-101108298 CCGCTCAGTCCCTCTCCCAGAGG + Intronic
1073185559 10:101613323-101613345 CCGCTAATCCCTGCAGCCAGGGG + Intronic
1076798861 10:132811515-132811537 CAGCTCATGCCCAGTGCCCGGGG - Intronic
1083648458 11:64186418-64186440 CCGCTCCCGCCCGCCGCCCGCGG - Intronic
1089260306 11:117219664-117219686 GCTATCATGCCAGCTGCCAGAGG + Exonic
1089297983 11:117481251-117481273 CAGCTCAAGCCCGCTGACCGTGG - Exonic
1090803879 11:130190535-130190557 CCGCTCATGCCCGCTGCCAGTGG + Exonic
1092475672 12:8817378-8817400 ACGTTCATGCCCTCTGCCAGTGG + Intergenic
1113745687 13:112742609-112742631 CCGCTTATGCCAGCTACCTGTGG + Intronic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1128115507 15:65102436-65102458 CGGCTCTTCCTCGCTGCCAGAGG + Exonic
1128979969 15:72179050-72179072 CCTCTGGAGCCCGCTGCCAGGGG - Intronic
1130963441 15:88680471-88680493 CCGCTCCTGGCCCCTGACAGAGG - Intergenic
1140376787 16:74451170-74451192 CCGCTCACTCCGGCTGGCAGTGG + Intergenic
1142136339 16:88453529-88453551 CCGCTCATGCCCCCGGCCCCCGG - Exonic
1142708347 17:1710126-1710148 CCGCTCGGGACCGCTGGCAGTGG - Exonic
1143223670 17:5282450-5282472 CCGCCCATCCCCGCTCCCCGAGG + Exonic
1143723368 17:8828848-8828870 CCGCTCAATGCCGCTGTCAGTGG + Exonic
1143756432 17:9071171-9071193 TCCCTCATGACCGCTGACAGAGG - Intronic
1146501365 17:33367577-33367599 CCCTTCATGCCTGCTGTCAGGGG + Intronic
1148654654 17:49274273-49274295 ACGCCCATGCCCGCTCCCACAGG + Intergenic
1151445535 17:74161120-74161142 CCACTCATCCTCGCTGCCTGGGG - Intergenic
1152179190 17:78807256-78807278 CAGCCCATGCCCGTTGGCAGTGG + Exonic
1152400904 17:80065618-80065640 CCGCACATCCTCGCTGCCTGTGG - Intronic
1152609932 17:81310409-81310431 CCGCTCCAGCCCTCTGCCTGGGG - Intergenic
1160913177 19:1484045-1484067 GCGATCATGCCGGCCGCCAGTGG + Exonic
1163636819 19:18440888-18440910 CCTCTCCTGCCACCTGCCAGGGG - Intergenic
1165128908 19:33620429-33620451 CCCCTCATGCGTGCAGCCAGTGG + Intergenic
1168287482 19:55341893-55341915 CTGCTCCTGCTCTCTGCCAGAGG + Exonic
927863822 2:26576416-26576438 CTGCTCACTCCCACTGCCAGTGG + Intronic
927998879 2:27506206-27506228 CTGCTCATGCCCCTTCCCAGTGG + Intronic
932221582 2:70003675-70003697 CCGGCCATGACGGCTGCCAGAGG + Intergenic
932491924 2:72127916-72127938 CCGCACATGCCCACTCCAAGGGG - Intergenic
932813660 2:74844601-74844623 CCACTCCTGTCTGCTGCCAGCGG - Intronic
1172205420 20:33159849-33159871 CAGCTCCTGCTCGCTGCCAGAGG - Intergenic
1172210901 20:33197884-33197906 CTGCTCATGGCTGCTGCGAGAGG - Intergenic
1175758552 20:61545684-61545706 CCGCTCATGCTTGGCGCCAGCGG + Intronic
1175892832 20:62322982-62323004 CGGCTGGTGTCCGCTGCCAGTGG + Intronic
1176257889 20:64162098-64162120 CCGCTCAGGCCGCCTCCCAGGGG + Intronic
1177504020 21:21998129-21998151 CACCTCATGGCCACTGCCAGGGG + Intergenic
1179198124 21:39184122-39184144 CCGCCCGTGCCCGCTGTCTGAGG - Intergenic
1179521614 21:41949152-41949174 CCTCTGATGGCCGCTGCCCGTGG - Intronic
1182524602 22:30907458-30907480 CTCCTCATGCCCCCTTCCAGCGG + Exonic
1182652242 22:31861467-31861489 CAGCTCATGGCGTCTGCCAGTGG - Intronic
1184217209 22:43075785-43075807 CTGGACATGCCCGATGCCAGAGG - Intronic
957555633 3:81761708-81761730 CCGCTCCTCCCCGCTGGCGGGGG - Exonic
961501455 3:127338555-127338577 CCTCTCATGCGCCCTGCCCGGGG - Intergenic
961800010 3:129440200-129440222 CCGCGCATGTACGTTGCCAGGGG + Exonic
968220885 3:196938938-196938960 CCCCTAATGCCCTTTGCCAGAGG - Intronic
968909280 4:3469398-3469420 CAGCCAATGCCCGCAGCCAGAGG + Intronic
969503636 4:7570372-7570394 CCTCCCACTCCCGCTGCCAGAGG + Intronic
970402872 4:15734850-15734872 CCGCTCCTGCCTGCTCCCTGTGG - Intronic
990149435 5:52800107-52800129 CCGCTGTTGCGTGCTGCCAGCGG + Exonic
992124376 5:73626054-73626076 CCGCGCCTCCCCGCTGCCACTGG - Intergenic
997228787 5:132228259-132228281 GCGCTCATGCCCATTGCCTGGGG + Intronic
999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG + Exonic
1001921716 5:175605822-175605844 CTGGTCATCCCAGCTGCCAGGGG + Intergenic
1002641038 5:180630797-180630819 CCACTCCTGTCCTCTGCCAGGGG - Exonic
1003271158 6:4609023-4609045 GCCCTCAGGCCCGCAGCCAGGGG - Intergenic
1006121153 6:31806768-31806790 CCGGTCCGGCCCGCTGCCCGCGG - Exonic
1007656823 6:43455595-43455617 GCGCTCAGGCCCCCTGCCAGGGG + Intronic
1016450708 6:144179535-144179557 CCACACATCCCCGCTACCAGAGG - Intronic
1018068732 6:160142386-160142408 CCGCTCATCACAGCAGCCAGAGG - Intronic
1018156152 6:160987040-160987062 GCTCCCATGCCCTCTGCCAGAGG - Intergenic
1019284787 7:218063-218085 ACGCTCAGGCCTGCTGCCTGTGG + Intronic
1019738639 7:2662304-2662326 CCCCTCCTGCCGGCTGCCAGAGG + Exonic
1021983676 7:26079135-26079157 CCGCGCATGCCCTGTGCCCGCGG + Intergenic
1024016892 7:45325463-45325485 CTCCTCATGCCTGCTGGCAGGGG + Intergenic
1024727182 7:52211546-52211568 CTGCTCATGCCCGCTGAGTGAGG - Intergenic
1027250139 7:76393724-76393746 GCGCACAGGCCCGCGGCCAGAGG + Intronic
1030408440 7:109143881-109143903 CAGCTGATGCCCACTGACAGAGG - Intergenic
1048328072 8:133453736-133453758 CTGCTCCTGCCCCCTGCCACGGG - Intergenic
1049262767 8:141648672-141648694 CCCATGATGCCCGCTGCCTGGGG - Intergenic
1053052292 9:34971914-34971936 CCCCTCTTCCCCGCTGCCATGGG + Intronic
1055549424 9:77417798-77417820 CCACTCCTGCTGGCTGCCAGAGG - Exonic
1061204540 9:129155370-129155392 CAGCTCCTGCCCTCTGCAAGGGG + Intergenic
1062098768 9:134717117-134717139 CCCCCCATTCCAGCTGCCAGGGG - Intronic