ID: 1090805500

View in Genome Browser
Species Human (GRCh38)
Location 11:130199684-130199706
Sequence CTCCCTCACAAATGCAGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 254}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090805500_1090805515 17 Left 1090805500 11:130199684-130199706 CCCTCGCTGCATTTGTGAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 254
Right 1090805515 11:130199724-130199746 AGGGTTTGAATTTGGGAGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 144
1090805500_1090805509 -3 Left 1090805500 11:130199684-130199706 CCCTCGCTGCATTTGTGAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 254
Right 1090805509 11:130199704-130199726 GAGGGGGAGGTGGGAAGATGAGG 0: 1
1: 0
2: 23
3: 278
4: 2178
1090805500_1090805518 27 Left 1090805500 11:130199684-130199706 CCCTCGCTGCATTTGTGAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 254
Right 1090805518 11:130199734-130199756 TTTGGGAGCGGGGAGAAGGAGGG 0: 1
1: 0
2: 7
3: 65
4: 622
1090805500_1090805512 10 Left 1090805500 11:130199684-130199706 CCCTCGCTGCATTTGTGAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 254
Right 1090805512 11:130199717-130199739 GAAGATGAGGGTTTGAATTTGGG 0: 1
1: 0
2: 3
3: 29
4: 448
1090805500_1090805516 23 Left 1090805500 11:130199684-130199706 CCCTCGCTGCATTTGTGAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 254
Right 1090805516 11:130199730-130199752 TGAATTTGGGAGCGGGGAGAAGG 0: 1
1: 0
2: 5
3: 41
4: 466
1090805500_1090805514 16 Left 1090805500 11:130199684-130199706 CCCTCGCTGCATTTGTGAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 254
Right 1090805514 11:130199723-130199745 GAGGGTTTGAATTTGGGAGCGGG 0: 1
1: 0
2: 1
3: 23
4: 289
1090805500_1090805510 -2 Left 1090805500 11:130199684-130199706 CCCTCGCTGCATTTGTGAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 254
Right 1090805510 11:130199705-130199727 AGGGGGAGGTGGGAAGATGAGGG 0: 1
1: 1
2: 13
3: 199
4: 1583
1090805500_1090805513 15 Left 1090805500 11:130199684-130199706 CCCTCGCTGCATTTGTGAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 254
Right 1090805513 11:130199722-130199744 TGAGGGTTTGAATTTGGGAGCGG 0: 1
1: 0
2: 2
3: 34
4: 382
1090805500_1090805511 9 Left 1090805500 11:130199684-130199706 CCCTCGCTGCATTTGTGAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 254
Right 1090805511 11:130199716-130199738 GGAAGATGAGGGTTTGAATTTGG 0: 1
1: 0
2: 2
3: 27
4: 331
1090805500_1090805517 26 Left 1090805500 11:130199684-130199706 CCCTCGCTGCATTTGTGAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 254
Right 1090805517 11:130199733-130199755 ATTTGGGAGCGGGGAGAAGGAGG 0: 1
1: 0
2: 3
3: 37
4: 513
1090805500_1090805519 28 Left 1090805500 11:130199684-130199706 CCCTCGCTGCATTTGTGAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 254
Right 1090805519 11:130199735-130199757 TTGGGAGCGGGGAGAAGGAGGGG 0: 1
1: 0
2: 5
3: 78
4: 836

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090805500 Original CRISPR CTCCCTCACAAATGCAGCGA GGG (reversed) Intronic
900836612 1:5009812-5009834 CTCCCTCACAAGTGCAACCAGGG - Intergenic
902693981 1:18127986-18128008 CTCCCTCACTAAAGGAGAGAGGG + Intronic
903562134 1:24236210-24236232 CTCCCTCTCAGAAGCAGCCAGGG - Intergenic
904428270 1:30445716-30445738 CACCCACACACCTGCAGCGACGG - Intergenic
904965973 1:34372962-34372984 CTCTCTCACAAATAAAGCAAAGG - Intergenic
906951242 1:50335886-50335908 CTCCCAGACAAATGCAGAGGAGG + Intergenic
907243296 1:53092420-53092442 CCACCTCACAAATGCGGGGACGG - Intronic
907292420 1:53425272-53425294 CTCCCCCAGAAACGCAGAGAAGG - Intergenic
907590839 1:55669482-55669504 CTCCTTCATTAATGCAGCCAAGG - Intergenic
907957742 1:59246993-59247015 CACCCTCACAGATGGAGCAATGG - Intergenic
907962972 1:59299653-59299675 CGCCCTCACAGATGGAGCAATGG + Intronic
908461931 1:64354790-64354812 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
908592239 1:65646942-65646964 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
908945098 1:69486178-69486200 CTCCCTGACAGAAGCAGGGAGGG - Intergenic
909281285 1:73756841-73756863 ATCCCTAAGAAATGCAGAGACGG + Intergenic
909909723 1:81246245-81246267 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
912989703 1:114473320-114473342 CGCCCTCACAGATGGAGCAATGG + Intronic
913711422 1:121487754-121487776 CTCCATCAGAAATGCAGCACTGG - Intergenic
914805266 1:150986766-150986788 CTCCCTCTCCAAGGCAGGGATGG - Intronic
917613105 1:176709993-176710015 CTCCCTCATACATGTAGCAAAGG - Exonic
917962970 1:180159004-180159026 CCCACTCACAAGTGCAGGGAGGG - Intronic
918346860 1:183614463-183614485 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
920132502 1:203743328-203743350 CACCCTCACCAATGCATCGGGGG - Exonic
921303541 1:213772902-213772924 TTCTCTCACAAATGCAGAAAGGG + Intergenic
922934627 1:229413439-229413461 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
923244529 1:232119070-232119092 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
924180414 1:241434806-241434828 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1068058566 10:52038584-52038606 CTCCCCCAGAAAAGCAGAGAAGG + Intronic
1073324103 10:102632630-102632652 CTCCCTCAGAGCTGCAGGGAGGG - Exonic
1073342220 10:102754275-102754297 CCCCCTCCCAAATGTAGCAAAGG - Intronic
1074597932 10:114884573-114884595 TTCCCTGACAAATGAAGGGAAGG - Intronic
1075229127 10:120657553-120657575 CTCCCTCTCATAAGCAGCCAAGG - Intergenic
1077611957 11:3648823-3648845 CTCCCCCAGAAAAGCAGAGAAGG - Intronic
1077886638 11:6391964-6391986 CTTCCTCACAAGTGCTGTGACGG - Exonic
1078901418 11:15646153-15646175 CTCCCTTACAGATGCAGAAATGG + Intergenic
1080028152 11:27633955-27633977 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1083627160 11:64077733-64077755 CTCCCTCGGCAATGCAGTGAGGG - Intronic
1084046952 11:66574544-66574566 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1084198917 11:67542437-67542459 CTCCCTCCCATATGCTGCTAGGG - Intergenic
1086136480 11:83447645-83447667 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1087098888 11:94346642-94346664 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1090102561 11:123815487-123815509 CTCCCTCACCAATGGGGTGAAGG + Intergenic
1090805500 11:130199684-130199706 CTCCCTCACAAATGCAGCGAGGG - Intronic
1092286135 12:7130209-7130231 CTCCCCCAAAATTGCAGCCAGGG + Exonic
1092723943 12:11467032-11467054 CTCCCCCAGAAAAGCAGAGAAGG + Intronic
1093268211 12:17026396-17026418 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1093584704 12:20821648-20821670 CTCCCCCAGAAAAGCAGAGAAGG + Intronic
1093678354 12:21970530-21970552 CTGCTTCACAAATACAGTGAGGG + Intergenic
1093950512 12:25160674-25160696 CTCTCTCACCAATGGAGCAATGG - Intronic
1094475486 12:30837472-30837494 CACCCTCACAGATGGAGCAATGG - Intergenic
1094606799 12:31956386-31956408 CGCCCTCACAGATGGAGCAATGG + Intergenic
1097200360 12:57273102-57273124 CTCCCTCCCAAGGGCAGAGAAGG + Intronic
1098104237 12:67052752-67052774 CTCTCTCAAAAATGAAGGGAGGG + Intergenic
1100213329 12:92421094-92421116 CGCTCTCACATATGCAGAGATGG + Exonic
1100561067 12:95749788-95749810 CTCCCCCAGAAAAGCAGAGAAGG - Intronic
1102322886 12:111953455-111953477 ATCCCTGACAAATGGAGCCAGGG + Intronic
1102531054 12:113547067-113547089 CTCCCACAGAAAGCCAGCGACGG + Intergenic
1103900252 12:124300168-124300190 CTGCCTCCCAGATGCAGAGACGG + Intronic
1105458802 13:20565500-20565522 CGCCCTCACAGATGGAGCAATGG - Intergenic
1107075346 13:36317284-36317306 CTCCCCCAGAAAAGCAGAGAAGG - Intronic
1107220531 13:37974020-37974042 CTCCCTCAGAAAAGCGGAGAAGG + Intergenic
1107374724 13:39789807-39789829 CGCCCTCACAGATGGAGCAATGG - Intronic
1108430812 13:50351920-50351942 CTATCTCACAAATGGAGAGAGGG + Intronic
1108913651 13:55583110-55583132 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1109255926 13:60082116-60082138 CACACTCAAAAATGCAGTGAGGG + Intronic
1109307005 13:60651959-60651981 TTCCCTCACACATGCAGAGAGGG + Intergenic
1112135977 13:96578129-96578151 CTCCCACACAAGTCCAGCAATGG + Intronic
1113117864 13:106892668-106892690 CCCCCTCACAGATGCCGGGAGGG + Intergenic
1113535060 13:111059491-111059513 CACCCTTACAAATGGAGCAATGG + Intergenic
1113744415 13:112733188-112733210 CTTCCCCACAAAAGCAGAGAGGG + Intronic
1115107834 14:29782283-29782305 CTGACTCACAAATGCATTGAGGG + Intronic
1117958132 14:61138217-61138239 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1119316967 14:73704367-73704389 CTCCCCCAGAAAGGCAGAGAAGG - Intergenic
1120097273 14:80403026-80403048 CTCCCTGCCTAATGCAGGGAGGG - Intergenic
1120106958 14:80506966-80506988 CTCCCTCACTATTGCAAGGACGG - Intronic
1121673681 14:95734175-95734197 CACCCTCACAGATGGAGCAATGG + Intergenic
1121703410 14:95973798-95973820 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1122120504 14:99550938-99550960 CTCCATCACCAATCCAGCAAAGG + Intronic
1126912594 15:53431525-53431547 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1128076053 15:64826133-64826155 GTCCCTTACAAAGGCAGAGAAGG - Intergenic
1128224098 15:65989672-65989694 CTCCCTCAGAATTGCAGCTTAGG - Intronic
1128897937 15:71392946-71392968 CTCCCTCTCAAAGGAAGCGCTGG - Intronic
1130414500 15:83679760-83679782 CTCCCTCACAAATAGAGTGGGGG - Intronic
1130947698 15:88561273-88561295 CTCCCTCAGAAAAGCAGAGAAGG + Intergenic
1131899463 15:97072055-97072077 CTACCTCACAAAAGCAGCTCCGG - Intergenic
1131927459 15:97401346-97401368 CTCCCTGACACCTCCAGCGATGG + Intergenic
1133361268 16:5175609-5175631 TTCCCTCACAAAATCAGCCAGGG - Intergenic
1133869833 16:9676283-9676305 CTCCCCCAGAAAAGCAGAGAAGG + Intronic
1134047222 16:11109674-11109696 CTCCCTCACACGTGCAGCCACGG + Intronic
1139039428 16:62983821-62983843 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1139039465 16:62983946-62983968 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1139039501 16:62984071-62984093 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1142983412 17:3684243-3684265 CTCCATCACAACTGCAGGGGAGG + Intronic
1145809359 17:27755426-27755448 GTCCCTCACAAATCCCACGAGGG + Intergenic
1145988362 17:29062583-29062605 CTCCCTTACAACTGCTGCCAAGG + Intergenic
1150250733 17:63703105-63703127 CTCCCTCATAATTCCAGAGAAGG - Exonic
1151460148 17:74249520-74249542 CCCCCTCACAGAAGCAGCTAAGG - Intronic
1151622276 17:75253557-75253579 CTCCCCCAGAAATGCAGAGAAGG - Intronic
1153130145 18:1846515-1846537 CTCTCTGAGAAATGCAGCCACGG - Intergenic
1155692068 18:28636780-28636802 CTGCTGCACAAATGCAGAGAAGG + Intergenic
1156026619 18:32662195-32662217 CTCTGACACAAATGCAGTGATGG - Intergenic
1159164272 18:64682654-64682676 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1161226540 19:3149459-3149481 CGCACCCACAAATGCAGCCAAGG + Intronic
1166017286 19:39991838-39991860 ATCCCTCACAAAGGAAGAGATGG + Intronic
925281987 2:2691132-2691154 CTCCCTCACAAAGGTAACTAAGG + Intergenic
925544291 2:5001722-5001744 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
925697757 2:6599219-6599241 CACCCACACAGATGCAGCAATGG - Intergenic
926167811 2:10532440-10532462 CTCCCTCACAACTTCAGAGGGGG + Intergenic
926407531 2:12570624-12570646 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
926407580 2:12570813-12570835 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
926413364 2:12627347-12627369 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
927347441 2:22062156-22062178 CTGCATCACAAAGGCAGAGAAGG - Intergenic
928276511 2:29905733-29905755 CTGCTTGACAAATGCAGCCAAGG - Intronic
929793294 2:45039224-45039246 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
930089940 2:47524816-47524838 CTCCCTCACCTATACAGTGATGG - Intronic
930658490 2:54030546-54030568 CTCCCTGACAATTGCACAGACGG - Intronic
931026609 2:58118161-58118183 CTCCCCCAGAAAAGCAGAGAAGG + Intronic
932297785 2:70641502-70641524 CTCTCTCACAATTACAGGGAAGG - Intronic
932367821 2:71164309-71164331 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
932367931 2:71164745-71164767 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
932854414 2:75218531-75218553 CTCCCCCAGAAAAGCAGAGACGG + Intergenic
934570998 2:95373373-95373395 CTCCCCCTCAAATGTAGCCATGG + Intronic
938015355 2:127862666-127862688 CTCCCACACAAGTCCAGCAATGG - Exonic
941936113 2:170982448-170982470 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
942296791 2:174525282-174525304 CTCCCTCACAAATGGGATGAAGG - Intergenic
945173232 2:207018133-207018155 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
946215283 2:218178919-218178941 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
948199217 2:236117906-236117928 GGCCCCCACAAATGCAGCGGAGG - Intronic
948891024 2:240907165-240907187 CTCCCACAAATGTGCAGCGATGG - Intergenic
1168849937 20:969602-969624 CTCCCTCACACGTGCCGGGAAGG - Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1173118659 20:40270017-40270039 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1173275911 20:41581960-41581982 CTTCCTCACAAATTCATCCATGG + Intronic
1178491903 21:33057811-33057833 CTCCCACAGACATGCAGCCACGG + Intergenic
1178836705 21:36104638-36104660 CGCCCTGACAGATGGAGCGATGG - Intergenic
1181436492 22:22914197-22914219 CTCCATCACAGCTGCAGCGGGGG + Intergenic
1184858221 22:47158051-47158073 CGCCCTCACAGATGCAGGGGTGG - Intronic
950749019 3:15114203-15114225 GTCCCTCCCAGATGCAGGGAGGG + Intergenic
950855545 3:16101413-16101435 CACCCTCACAGATGGAGCAATGG + Intergenic
952663670 3:35879128-35879150 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
952896739 3:38082663-38082685 CTCCCCCAGAAAAGCAGAGAAGG + Intronic
952896755 3:38082720-38082742 CTCCCCCAGAAAAGCAGAGAAGG + Intronic
953825925 3:46251069-46251091 CTCCCCCAGAAAAGCAGAGAAGG + Intronic
953972809 3:47360212-47360234 CGCCCTCACAGATGGAGCAATGG + Intergenic
954480969 3:50801147-50801169 CACCCTCACAGATGGAGCAATGG + Intronic
957294987 3:78324610-78324632 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
957317535 3:78587942-78587964 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
957996369 3:87695226-87695248 CTCCCTCAGAACAGCAGCAATGG + Intergenic
959485977 3:106927444-106927466 CTCCCTCAGAAAAGCAGAGAAGG + Intergenic
959532784 3:107452348-107452370 CTCCTTCAGAAATGCTGCCATGG - Intergenic
960310349 3:116110140-116110162 CTCCCCCAGAAAAGCAGAGAAGG + Intronic
961880801 3:130060063-130060085 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
963425017 3:145113991-145114013 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
963521411 3:146363012-146363034 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
963607354 3:147422493-147422515 CTCCCTGAAAAGGGCAGCGAAGG + Intronic
963684092 3:148415200-148415222 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
963781897 3:149494772-149494794 CTCCTTCTCAAATTCATCGATGG - Intronic
964158771 3:153620273-153620295 CTTCCTCACAAATGCAAGAAAGG - Intergenic
966085224 3:176062265-176062287 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
967246525 3:187492190-187492212 CTCCACCACAAATGCAGCTGGGG + Intergenic
967624897 3:191671389-191671411 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
968993187 4:3928353-3928375 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
970266676 4:14296040-14296062 CTCTCTCTCAGAGGCAGCGAAGG - Intergenic
970790850 4:19855753-19855775 CTCCCTCACAATTGCAAGAATGG + Intergenic
971066850 4:23042579-23042601 CGCCCTCACAGATGAAGCAATGG - Intergenic
972287584 4:37663591-37663613 CTTCCTTACAGATGCTGCGAGGG - Intronic
975865330 4:78718744-78718766 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
976696313 4:87922756-87922778 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
978001330 4:103558504-103558526 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
979770692 4:124521563-124521585 CGCCCTCACAGATGGAGCAATGG + Intergenic
979850539 4:125566480-125566502 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
980284749 4:130768328-130768350 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
980341167 4:131549061-131549083 CACCCTCACAGATGGAGCAAAGG - Intergenic
980611990 4:135172089-135172111 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
981040061 4:140214606-140214628 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
981524931 4:145699849-145699871 CTCCCCCAGAAAAGCAGAGAAGG - Intronic
984393811 4:179169581-179169603 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
986555788 5:9008734-9008756 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
986555911 5:9009431-9009453 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
986919814 5:12667360-12667382 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
988707309 5:33738919-33738941 TTCCCTAAGAAATGCAGCCAGGG + Intronic
989388590 5:40877586-40877608 CACCCTCACAGATGGAGCAATGG + Intergenic
990149614 5:52801017-52801039 CTCCCTCACAAATCCTGGGCTGG - Exonic
992394426 5:76358207-76358229 CTCACTCAGAAAAGCAGAGAAGG - Intergenic
993836439 5:92824690-92824712 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
993836469 5:92824815-92824837 CTCCCTCAGAAAAGCAGAGAAGG - Intergenic
994532766 5:100989070-100989092 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
994532781 5:100989131-100989153 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
994532816 5:100989256-100989278 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
994830535 5:104776374-104776396 CATACTCACAAATGGAGCGATGG + Intergenic
996527843 5:124497961-124497983 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
999128574 5:149265268-149265290 CTCCCTCACACAGACAGCAAAGG - Intergenic
999232487 5:150069862-150069884 CTCCCTCTCACCTGCAGAGATGG + Exonic
1000072223 5:157751418-157751440 CCCCCTCACGGATACAGCGATGG - Exonic
1000881667 5:166704973-166704995 CTCCCTCATAAATGAGGTGAAGG + Intergenic
1001718977 5:173841003-173841025 CTGCCTCACATTTGCAGCCATGG - Intergenic
1002652475 5:180710322-180710344 CTCTCTGAAAAATGCAGCAAGGG - Intergenic
1003430411 6:6032659-6032681 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1004283780 6:14301856-14301878 CTCCCCCAGAAAGGCAGAGAAGG + Intergenic
1012841129 6:104330473-104330495 CTCCCTAAAAAATTCAGCTATGG - Intergenic
1013812334 6:114059088-114059110 CTCCCTGAGAAAAGCAGAGATGG - Intronic
1014718391 6:124891355-124891377 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1015269428 6:131324263-131324285 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1016650505 6:146455191-146455213 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1018191109 6:161309750-161309772 CACCCTTACAGATGCAGCAATGG + Intergenic
1020315821 7:6904700-6904722 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1022722884 7:32957085-32957107 CTCCCTCTCCAAAGCAGCAAGGG + Intergenic
1024804247 7:53118102-53118124 CTCCCAGAGAAATGCAGCCATGG + Intergenic
1025870809 7:65432361-65432383 CTACATCACGAATGCAGCAAGGG - Intergenic
1027851731 7:83460619-83460641 CTCCCCCAGAAAAGCAGAGAAGG - Intronic
1028793373 7:94878104-94878126 CTCCCTCACAGATGGAGCAAAGG - Intergenic
1031525331 7:122817685-122817707 CTCCCGCAGAAAAGCAGAGAAGG - Intronic
1031777110 7:125918487-125918509 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1033148213 7:138889969-138889991 CTCCCTCCCACATGCAGCATAGG + Intronic
1035831252 8:2696935-2696957 CTCCCTCCCAGATTCAGGGAAGG - Intergenic
1039310504 8:36313491-36313513 CTCCATCACAAGAGCAGCAAGGG + Intergenic
1041012509 8:53558714-53558736 CTCCCTCACACACCCAGAGAAGG + Intergenic
1042927767 8:73984016-73984038 CGCCCTCACAGATGGAGCAATGG + Intergenic
1044061100 8:87636600-87636622 CGCCCTCACAGATGGAGCAATGG - Intergenic
1044148704 8:88746885-88746907 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1044258816 8:90094898-90094920 CTCCCCCAGAAAAGCAGAGAAGG + Intronic
1044921741 8:97175968-97175990 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1044921775 8:97176092-97176114 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1045104543 8:98878692-98878714 CACCCTTACAAATGGAGCAATGG - Intronic
1045197257 8:99944629-99944651 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1046293906 8:112196793-112196815 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1046630252 8:116616650-116616672 TTCCTTCACAAATGCAGCTGAGG - Intergenic
1048585636 8:135771921-135771943 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1052122054 9:24730407-24730429 CTCCATCACAAGTCCAACGAAGG - Intergenic
1052353065 9:27476790-27476812 CTTCAGCACAAATGCAGAGATGG - Intronic
1053576773 9:39362436-39362458 CTCCCTGACAAAGGCTGGGATGG + Intergenic
1053841282 9:42190361-42190383 CTCCCTGACAAAGGCTGGGATGG + Intergenic
1054098341 9:60921127-60921149 CTCCCTGACAAAGGCTGGGATGG + Intergenic
1054119742 9:61196757-61196779 CTCCCTGACAAAGGCTGGGATGG + Intergenic
1054588012 9:66985805-66985827 CTCCCTGACAAAGGCTGGGATGG - Intergenic
1055568855 9:77595985-77596007 CTCCCTCAGACCTGCAGGGAGGG + Intronic
1055809818 9:80138246-80138268 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1055986034 9:82056996-82057018 CTCCCTGACAAAGGCTGGGATGG - Intergenic
1056311615 9:85346975-85346997 ATCCCTCTCAAATGCAACAAAGG + Intergenic
1056585300 9:87924135-87924157 CTCCCTGACAAAGGCTGGGATGG + Intergenic
1056611581 9:88128805-88128827 CTCCCTGACAAAGGCTGGGATGG - Intergenic
1057377769 9:94540762-94540784 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1059546368 9:115179391-115179413 CTCCTTCAGAAAAGCAGAGAAGG + Intronic
1059976590 9:119724469-119724491 ATCCCTGACAAATGCAGGAAAGG - Intergenic
1060738116 9:126079478-126079500 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1061426231 9:130500079-130500101 CTGCCTCACAGATGCAGTGAAGG + Intronic
1062187394 9:135225159-135225181 CTCCCTGACAAAGGCTGCGGTGG - Intergenic
1185858803 X:3559191-3559213 CTCCCTCAGAAAAGCAGAGAAGG + Intergenic
1190741695 X:53292963-53292985 CACCCTCACTCATGCTGCGAAGG + Intronic
1193350314 X:80456199-80456221 CTCCCACAAAAATCCAGCAATGG - Intergenic
1194058319 X:89164522-89164544 CACCCTCACAGATGGAGCAATGG + Intergenic
1194091608 X:89585654-89585676 CTGCCTCAGAAATGCAGGGAGGG - Intergenic
1194186448 X:90778052-90778074 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1195772810 X:108370327-108370349 CCTCCTCACAAATTCAGAGATGG + Intronic
1196072844 X:111544764-111544786 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1196165316 X:112531484-112531506 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1196493739 X:116298879-116298901 CTCCCTCAGTAAAGCAGAGAAGG - Intergenic
1196774069 X:119322503-119322525 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1196961771 X:121011215-121011237 CTCCCTCACAATAGCATGGATGG - Intergenic
1198598208 X:138259577-138259599 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1198868936 X:141155616-141155638 CACCCTCACAGATGGAGCAATGG - Intergenic
1199278196 X:145970752-145970774 CGCCCTTACAGATGGAGCGATGG - Intergenic
1199466883 X:148147973-148147995 CTCTCTGACAAATGCAACTAAGG - Intergenic
1199576272 X:149316674-149316696 CTCCCCCAGAAAAGCAGAGAAGG - Intergenic
1200444244 Y:3241716-3241738 CTGCCTCAGAAATGCAGGGAGGG - Intergenic
1200533048 Y:4360128-4360150 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic
1202076763 Y:21044207-21044229 CTCCCCCAGAAAAGCAGAGAAGG + Intergenic