ID: 1090806993

View in Genome Browser
Species Human (GRCh38)
Location 11:130209006-130209028
Sequence GGGTGGGTATGAAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 463}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090806984_1090806993 2 Left 1090806984 11:130208981-130209003 CCAGTGGTGCTTAAGGCACGTGA 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG 0: 1
1: 0
2: 1
3: 46
4: 463
1090806983_1090806993 3 Left 1090806983 11:130208980-130209002 CCCAGTGGTGCTTAAGGCACGTG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG 0: 1
1: 0
2: 1
3: 46
4: 463
1090806981_1090806993 10 Left 1090806981 11:130208973-130208995 CCTTAAGCCCAGTGGTGCTTAAG 0: 1
1: 0
2: 1
3: 9
4: 126
Right 1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG 0: 1
1: 0
2: 1
3: 46
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090806993 Original CRISPR GGGTGGGTATGAAGGGAAGC AGG Intronic
900088218 1:908661-908683 GGGAGGGGATGAGGGGAAGGTGG + Intergenic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
901380856 1:8873096-8873118 GGGTGGATATGTAGGGAGCCAGG - Intronic
902209345 1:14893535-14893557 GGGTGTGGAGGAAGGGAAGATGG - Intronic
902828345 1:18992966-18992988 GGGTGGGCATGAATGGAAGAGGG - Intergenic
903154657 1:21435733-21435755 GGGAGGGGGTGAGGGGAAGCTGG - Intergenic
903224023 1:21884966-21884988 GGGTGGGAATGAGGGGCAGCTGG - Intronic
903740303 1:25554806-25554828 GGGTGGGTCTCAAGTGAGGCTGG + Intronic
903761828 1:25703858-25703880 GGGTGGCCATGAAGGAAAGCAGG - Intronic
903874610 1:26464896-26464918 GGGTGGATCGTAAGGGAAGCAGG + Intronic
903995942 1:27305634-27305656 GGGTGGGTAGCCAGGGAAGCTGG + Intronic
906381766 1:45337006-45337028 GTTTGGCTATGAAGGGAAGGAGG - Intronic
907273758 1:53305734-53305756 GGGTGGAGGTGCAGGGAAGCTGG - Intronic
907310387 1:53535656-53535678 GGGTGGATAAGAAGAGAAGGGGG - Intronic
907506538 1:54923163-54923185 GGGTGGGGAGGGAGGGAGGCAGG - Intergenic
908135290 1:61125940-61125962 GGGTGGGGATGAAGGTTTGCAGG + Intronic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909506427 1:76395828-76395850 GGCTGGGGATGAAGAGAGGCTGG + Intronic
912042197 1:105405943-105405965 GGGTGGGAATGTAGGGAGACTGG + Intergenic
912211348 1:107560562-107560584 AGGGGGGTGGGAAGGGAAGCAGG + Intergenic
912422980 1:109558854-109558876 GAGTGGGAAAGAAGGGATGCAGG + Intronic
912799467 1:112712084-112712106 GAGTGGGTCTGAAGAGAACCAGG - Intronic
913185025 1:116363058-116363080 GGATAGGGATGCAGGGAAGCTGG - Intergenic
913338342 1:117732107-117732129 GAGTGGGTATGAGGAGATGCTGG + Intergenic
913564407 1:120057881-120057903 GGGTAGGTATTTAGGGAAACTGG - Intronic
913633721 1:120735683-120735705 GGGTAGGTATTTAGGGAAACTGG + Intergenic
914284994 1:146217230-146217252 GGGTAGGTATTTAGGGAAACTGG - Intronic
914546025 1:148667969-148667991 GGGTAGGTATTTAGGGAAACTGG - Intronic
914620539 1:149402697-149402719 GGGTAGGTATTTAGGGAAACTGG + Intergenic
914678487 1:149922206-149922228 GAGTGGATATTGAGGGAAGCTGG - Intergenic
915858298 1:159414221-159414243 GGGTGGTGATGAAGAGAAGTTGG - Intergenic
916070736 1:161168232-161168254 GGTGGGGTATGAAGAGAAGAGGG - Intronic
917711196 1:177687289-177687311 GGGTGGGTCTGAGAGGAAGAGGG - Intergenic
917725237 1:177821413-177821435 GGGAGGGTGGGAAGGGAAGTGGG + Intergenic
918107284 1:181425799-181425821 GGGAGGGAATGAAGGCATGCAGG + Intronic
918190302 1:182167491-182167513 GGGCTGGGAGGAAGGGAAGCGGG + Intergenic
919310155 1:195896650-195896672 AGTTGGGGATGAAGGCAAGCAGG + Intergenic
920676552 1:208042270-208042292 GGGTGCGGATGAAGGTCAGCAGG + Exonic
921000306 1:211037227-211037249 GGGTGAGTAAGCAGAGAAGCTGG + Intronic
922318035 1:224459610-224459632 GGGTGGGGGTGGAGTGAAGCTGG + Intronic
922554396 1:226521870-226521892 GAGGGGGTATGAAGAGAAGGTGG - Intergenic
922723474 1:227910727-227910749 GGGTGGTGAGGAAGGGAATCAGG - Intergenic
923016180 1:230128273-230128295 GTGTGGTTATGAAGGAAAACAGG + Intronic
923284499 1:232479638-232479660 TGTTGGGCATGTAGGGAAGCAGG + Exonic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923946839 1:238897933-238897955 GGGTGAATAAGGAGGGAAGCAGG + Intergenic
923964515 1:239122390-239122412 TGGTAGGAATGAAGAGAAGCTGG + Intergenic
1063009061 10:2004505-2004527 GAGTGGGCATGACGGGGAGCTGG + Intergenic
1063386243 10:5617873-5617895 GGGCAGGTAGGCAGGGAAGCAGG + Intergenic
1064156211 10:12905442-12905464 GGATGGGTTTGGAGGGCAGCTGG + Intronic
1065021039 10:21501567-21501589 GGGTGGGGAGGAAGAGGAGCAGG + Intergenic
1065897280 10:30175111-30175133 AAGAGGGTATGAAGGGAAGTTGG - Intergenic
1066286554 10:33972100-33972122 GGAGGGGTATGAAGGGAATGAGG - Intergenic
1067756971 10:49012561-49012583 GGCTGGGTATCAAGAGATGCAGG + Intergenic
1068603768 10:58982666-58982688 GGGAGGTGATGCAGGGAAGCTGG + Intergenic
1069553107 10:69378138-69378160 GGCTGGGAAGGAAGGGGAGCGGG + Intronic
1070692648 10:78539101-78539123 GGGTGGGTTGAAAGGGGAGCTGG - Intergenic
1071287411 10:84161813-84161835 GGCTGGGTATGAAGGGGTGGGGG + Intergenic
1071684194 10:87737247-87737269 GGGTGGGTGTGAAGAGCACCTGG - Intronic
1072636989 10:97184880-97184902 GGCTGGGTGTGGAGGGAGGCGGG + Intronic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1075112188 10:119596524-119596546 GGGTGGGGAGGAAGGGGAGGGGG + Intronic
1075538056 10:123287743-123287765 GGGAGGGTGTGAAGGGAGCCTGG - Intergenic
1075701020 10:124469481-124469503 GGGCTGGTGTGAAGGGAAGGTGG - Intronic
1076166193 10:128284665-128284687 GGGTGGTTCTGAATGGGAGCTGG + Intergenic
1076637535 10:131892041-131892063 GGCTGGGCTTGGAGGGAAGCTGG + Intergenic
1077299501 11:1840474-1840496 AGGTGGGTCTGCAGGGGAGCTGG + Intronic
1077556792 11:3229911-3229933 GGGAGGGGATGGAGGGAGGCTGG - Intronic
1077652487 11:3985769-3985791 AGTTAGGTCTGAAGGGAAGCAGG - Intronic
1077846475 11:6030503-6030525 GGGAGGGGAGGAAGGAAAGCAGG + Intergenic
1078524326 11:12089154-12089176 AAGTGGGTATGCAGGGAGGCTGG - Intergenic
1079642822 11:22828618-22828640 GTGTGGTTATCAAGGGAAGAGGG + Intronic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1082274017 11:50201944-50201966 GGGTAGGTTTGCAGGGAAGATGG - Intergenic
1083300236 11:61736245-61736267 GGGTGGGCAGGAACAGAAGCAGG - Intronic
1083476493 11:62918903-62918925 GGGAGGGAATGAGGGGATGCTGG + Intronic
1083605006 11:63973277-63973299 GGGTAGGAAGGAAGGGAAGTTGG + Intergenic
1083877383 11:65531466-65531488 GGGTGGGAATGAAGTGATGGCGG - Intronic
1084073421 11:66753205-66753227 GTGTGTGTATGCAGGCAAGCAGG + Intronic
1084416725 11:69036753-69036775 GAATGGGCATGAAGGGAAGGGGG + Intergenic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085926504 11:81029962-81029984 GGGTTGGCAAGAAGGTAAGCAGG - Intergenic
1086095990 11:83050333-83050355 GTGTGGGTAGTAAGGGGAGCGGG - Intronic
1086126219 11:83351242-83351264 GGGTGGGCATGATGGTGAGCTGG - Intergenic
1087152097 11:94868455-94868477 GGGTGGGGAAGAGGGGATGCTGG - Intronic
1087189909 11:95242759-95242781 GGGTGGTTATAAAGGGGACCAGG + Intergenic
1089194285 11:116684053-116684075 GGGTGGGGGTGGAGGGGAGCGGG - Intergenic
1089559438 11:119336427-119336449 GGGTGGGCAGGCAGGGAAGGAGG - Exonic
1090010353 11:123040380-123040402 GGGGGTGTCTGAAAGGAAGCTGG + Intergenic
1090339501 11:126004044-126004066 GGGTTGGCATGCTGGGAAGCTGG - Exonic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1091402366 12:188862-188884 GGGTGGGGATGGAGGGAACGGGG - Intergenic
1091635802 12:2195623-2195645 GGGTAGGGATGAAGGCAAGGAGG + Intronic
1091783969 12:3231221-3231243 AGGGGAGAATGAAGGGAAGCGGG + Intronic
1091787044 12:3249349-3249371 TGGTGGGCAGGAAGGAAAGCAGG - Intronic
1091796682 12:3301248-3301270 GAGTGAGGATGAAGGGGAGCAGG + Intergenic
1093838657 12:23868690-23868712 GGGTGGGAATGAAGGGATATGGG - Intronic
1095914356 12:47461137-47461159 GGGAGGGTAAGAAAGGAAACTGG + Intergenic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096752400 12:53769442-53769464 GGGGTGGTGGGAAGGGAAGCGGG - Intergenic
1096801867 12:54115718-54115740 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097309064 12:58098881-58098903 GAGTGTTTATAAAGGGAAGCAGG - Intergenic
1097776885 12:63657588-63657610 TGGTGGGTATCCAGTGAAGCTGG - Intronic
1099005770 12:77233210-77233232 GGGAGGGAATGAAGGAAAGAAGG - Intergenic
1099182274 12:79482524-79482546 AGGTGGGGAGGAAGGGAAGGTGG + Intergenic
1099182735 12:79486356-79486378 GGGTGGGGATGAAGAGCGGCAGG - Intergenic
1100223971 12:92537898-92537920 TGCTGTGCATGAAGGGAAGCTGG - Intergenic
1101155631 12:101925018-101925040 GGGAGGGTATGAAGGGAAAGGGG - Intronic
1101439019 12:104689231-104689253 GGTTGGGTAGGAAGGGATTCTGG - Intronic
1102129136 12:110511582-110511604 GGGTGAGTATGAAGAGAGGTTGG + Intronic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102576123 12:113857253-113857275 GGGTGGCTCTGAAGGGAACCAGG + Intronic
1104474946 12:129063592-129063614 TGGTGGGTCTGCAGAGAAGCTGG - Intergenic
1104749518 12:131229550-131229572 AGGTGGGTCTGCAGGGAGGCCGG - Intergenic
1105765169 13:23552147-23552169 GAGTGGGTAGGAGGGGAAGGAGG + Intergenic
1106456370 13:29930752-29930774 GGGAGGATATAAAGGGAAGAGGG + Intergenic
1106665557 13:31847084-31847106 GGGTGGGGACCGAGGGAAGCGGG + Intergenic
1106956211 13:34942189-34942211 GGGTGGGTGGGAAGAGAAGGAGG + Intergenic
1107411456 13:40162305-40162327 TGGTGGGCATGAACGGCAGCAGG - Intergenic
1109405820 13:61898812-61898834 GGGAGGGAAGGAAGGGAAGAAGG - Intergenic
1111118279 13:83811162-83811184 TGGTAGGTATGAAGGGCAGATGG - Intergenic
1112138847 13:96615317-96615339 GGGTGGGTAAAAAGAGAATCAGG - Intronic
1113959548 13:114119055-114119077 GGGTGGGTCAGGAGGAAAGCGGG - Intronic
1114459411 14:22877200-22877222 GGGTGGGCAAGATGGGGAGCAGG + Exonic
1114755255 14:25252609-25252631 TGGTGTGTATGTAGGGCAGCTGG + Intergenic
1114891411 14:26928654-26928676 GGGTGGGTGGGAGGGGAAGTGGG + Intergenic
1115157844 14:30360566-30360588 GTGTGGAAATGAAGGGAAGGAGG + Intergenic
1115975769 14:38995429-38995451 GGGTGGGCATAAAGGGAAGAGGG - Intergenic
1116895100 14:50308613-50308635 TGGTGAGAATGAAGGGAAACTGG + Intronic
1117702523 14:58427674-58427696 GGGCGGGTTTGAAGGGAAGTGGG + Intronic
1117814686 14:59584722-59584744 GTCTGGCAATGAAGGGAAGCAGG - Intergenic
1119115280 14:72014822-72014844 AGACGGGTATGGAGGGAAGCGGG - Intronic
1120039197 14:79733134-79733156 AGGTGGGGGTGAAGGGAAGATGG + Intronic
1120673261 14:87388608-87388630 AGGTGGTTCTGATGGGAAGCTGG - Intergenic
1120762068 14:88293978-88294000 GGGTGGATGAGAATGGAAGCAGG - Intronic
1120884453 14:89441083-89441105 GGTTGGGGAGGAAGGGAAGCCGG - Intronic
1121316558 14:92964403-92964425 GGGTGGGGAGGGAGGGGAGCTGG + Intronic
1121668772 14:95692253-95692275 TGGTGGGTATGAAGGGGATTTGG - Exonic
1121798742 14:96756073-96756095 GGGTGGGCAAGAAGGGAAGGCGG + Intergenic
1121920353 14:97875098-97875120 GGATGGATAAGAAGGGATGCTGG - Intergenic
1122124566 14:99572117-99572139 GGGAGGGTATGTGGGGAATCTGG - Intronic
1122329530 14:100903318-100903340 GGCTGGGGATGAAGTGATGCCGG + Intergenic
1122403343 14:101480727-101480749 GGGTGTTTATGAAGGAAAGCGGG + Intergenic
1122738873 14:103859447-103859469 GGGAGGGAAGGAAGGGAAGGGGG + Intergenic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1123037564 14:105477709-105477731 GGGTGTGTGTGGGGGGAAGCGGG + Intronic
1123118671 14:105906960-105906982 GGGTGTGTAAGAGGGGATGCGGG - Intergenic
1123439895 15:20282580-20282602 GGATCAGTGTGAAGGGAAGCTGG - Intergenic
1125387110 15:39149581-39149603 GGGTGGGGAAGAAAAGAAGCAGG + Intergenic
1125918877 15:43512647-43512669 GGGTGTCTGTAAAGGGAAGCAGG - Intronic
1126825372 15:52543043-52543065 GGTGGGGTATGAAGGGAAGAGGG - Intergenic
1127290115 15:57562522-57562544 CGCTGGGTAATAAGGGAAGCAGG - Intergenic
1127478242 15:59354848-59354870 GGGTAGCTGTGGAGGGAAGCTGG - Intronic
1128338722 15:66805022-66805044 GGGGTGGGATGAAGGGAAGGTGG + Intergenic
1129156222 15:73719810-73719832 GGGTGGGTAGGTAGGTAGGCAGG - Intergenic
1129535944 15:76313814-76313836 GGGTGGGGAGGTAGGGAAGGAGG - Intergenic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130396212 15:83504377-83504399 GGGTGGGTATGAAGACCAGAAGG - Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1131055478 15:89372052-89372074 AGATGGGTGTGAAGGGAAGGTGG + Intergenic
1131544452 15:93304342-93304364 GGGTGAGGATGAAGAGAGGCTGG - Intergenic
1132009888 15:98266631-98266653 TGGTGGGTTTGAAAGGAAGTGGG + Intergenic
1132031755 15:98444390-98444412 AGTTAGGAATGAAGGGAAGCCGG - Intronic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1132794568 16:1713022-1713044 GTGTGTGGATAAAGGGAAGCCGG + Intronic
1133234242 16:4380436-4380458 GGGTGTGTAAGCAGAGAAGCTGG - Intronic
1133402671 16:5500141-5500163 GGGAGGGGAGGAAGGGAAGGAGG - Intergenic
1133787879 16:8986979-8987001 GGGAGTGCATGAAGGGAAGTAGG - Intergenic
1133867488 16:9657972-9657994 GACTGGGGATGAAGGCAAGCAGG - Intergenic
1134063161 16:11211111-11211133 GGGAGGGTAGGAAGGGCACCCGG - Intergenic
1135254441 16:20929762-20929784 AGGTGGGGATGTAGGGAAGGTGG - Intergenic
1135414751 16:22260528-22260550 GGGTGAGTGTGAAGGGAGGGAGG + Exonic
1135553410 16:23415808-23415830 GGAAGGGTATTAAGGGAGGCAGG - Intronic
1136730343 16:32405933-32405955 GGGAAGGGATGAAGGGAAGAAGG - Intergenic
1136845276 16:33571817-33571839 GGATCAGTGTGAAGGGAAGCTGG + Intergenic
1137496086 16:48970420-48970442 AGGTGGGTCTGAAGGCGAGCGGG + Intergenic
1137614026 16:49836367-49836389 GGGTTGGCATGGAGGGAAGGGGG + Intronic
1137692699 16:50440680-50440702 GGGTGGGTTTGAAAGGCAGCAGG + Intergenic
1137961402 16:52885385-52885407 GGATGGGAAAGGAGGGAAGCAGG - Intergenic
1138807854 16:60112451-60112473 GGATGGGAATGAAGAGAAGTGGG - Intergenic
1139527300 16:67524863-67524885 GTGTGTGTATGAGGGGAGGCAGG - Intronic
1139870301 16:70102953-70102975 GGCTGGATATGAAAAGAAGCAGG + Intergenic
1140828051 16:78726061-78726083 GGGAGGGAGGGAAGGGAAGCAGG - Intronic
1141589208 16:85056526-85056548 GGGTGGGTTTTAAGTGGAGCTGG - Intronic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141685446 16:85567219-85567241 GGGTGGGTCTGCAGGGGACCAGG + Intergenic
1141870263 16:86780547-86780569 GGGTCGGGAAGAAGGGAAGGCGG - Intergenic
1142128287 16:88420937-88420959 GGGTCGGGAGGAAGGGAAACGGG + Intergenic
1142361578 16:89630178-89630200 GGGTGGGTAGGATGGAAGGCCGG - Intronic
1142368440 16:89663685-89663707 GGGTGTGTCTGAAGGGCAGCAGG + Intronic
1203106984 16_KI270728v1_random:1420470-1420492 GGATCAGTGTGAAGGGAAGCTGG + Intergenic
1203155444 16_KI270728v1_random:1872115-1872137 GGATCAGTGTGAAGGGAAGCTGG + Intergenic
1142762851 17:2051622-2051644 GGGTGGGCAGGAGAGGAAGCTGG + Intergenic
1143381403 17:6498516-6498538 GAGTGGGTGAGATGGGAAGCAGG + Intronic
1143523576 17:7460315-7460337 GGGAGGGTATGAGGGGTAGGAGG + Exonic
1145733276 17:27209912-27209934 GGGAGGGGAGGGAGGGAAGCAGG - Intergenic
1145760877 17:27425086-27425108 TTGTGGGTACCAAGGGAAGCTGG - Intergenic
1145883007 17:28365317-28365339 CGGTGGGGAAGAAGGGAGGCTGG + Intronic
1146086417 17:29833944-29833966 GGGAGGGTAGGAAGGGAAGGAGG - Intronic
1146095907 17:29930093-29930115 GGGTGGGGGTGAAGGGAACGGGG + Exonic
1146564498 17:33900748-33900770 GGGAGGGTATCTAGGGAAGAGGG + Intronic
1147178633 17:38671936-38671958 GTTGAGGTATGAAGGGAAGCTGG - Exonic
1148518128 17:48241364-48241386 GGGTGGTACTGAAGGGAAGCAGG + Intronic
1148945668 17:51260103-51260125 AGGAGGGTATGTAGGGAAGTGGG - Intronic
1150073030 17:62168758-62168780 TGTTGGGTATGAGAGGAAGCTGG - Intergenic
1150810564 17:68353590-68353612 CGGTGGGTAAGAAGGGCAGCAGG - Intronic
1150935348 17:69629064-69629086 GGCTGGGGCTGAAGGGAAGGGGG + Intergenic
1151389665 17:73777508-73777530 GGGTGGGTAGGGCGGGCAGCTGG - Intergenic
1151852834 17:76701147-76701169 GGGTGGGGAGGACGGGAAACAGG + Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1152009506 17:77702682-77702704 GGGTTGGTAGGAAGAAAAGCAGG - Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG + Intergenic
1153273977 18:3350164-3350186 GGCTGGGAATGAAGAGAAACGGG + Intergenic
1153973592 18:10247661-10247683 GGGTGGGGAGGAAGGAAACCCGG + Intergenic
1154056404 18:11016482-11016504 GGGTGGGTATGAGGGGGGTCGGG + Intronic
1154251416 18:12748093-12748115 GGGTGGGAATGAAGAGCTGCTGG - Intergenic
1154369396 18:13745300-13745322 GGGAGAGTAAGAATGGAAGCAGG + Intronic
1155063903 18:22252764-22252786 GTGTGGGTTTGATAGGAAGCAGG - Intergenic
1155612630 18:27684185-27684207 GGGTGGGAATGAATGGAAGAGGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1156214023 18:34977697-34977719 GGGTGGGTGCAAAAGGAAGCGGG + Intronic
1156526078 18:37768562-37768584 GGGTGGGTGTGAAAGGTAGGTGG - Intergenic
1156850495 18:41720200-41720222 GGATGGGTAGGAAGGGAGGAAGG - Intergenic
1157315131 18:46580476-46580498 GGCTGGGCATGCAGGGATGCAGG - Intronic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1157639679 18:49202035-49202057 TGTTGGGTAAGAAGGGAAGATGG - Intronic
1158686976 18:59623450-59623472 GGGTGGGTTCGAAAAGAAGCTGG - Intronic
1158908029 18:62033032-62033054 GGTTGGGGACCAAGGGAAGCTGG + Intergenic
1160136969 18:76280567-76280589 GGGTGGGTGTGGAGGGACGTGGG - Intergenic
1160872153 19:1282432-1282454 GGGAAGGTGTGAAGGGAAGGAGG + Intergenic
1160901018 19:1428772-1428794 GGGTGTGTCTAAAGGGAAGGGGG + Intronic
1161268927 19:3378737-3378759 GGGTGGGTCTGCAGGGAACGGGG + Intronic
1161758903 19:6156290-6156312 AGTTGGGGAGGAAGGGAAGCTGG + Intronic
1161994953 19:7706293-7706315 GGGTGGGGAGGAAGGGCAGTAGG + Intergenic
1162022992 19:7876438-7876460 GGGTGGGTAGACAGGGAACCAGG - Intergenic
1162024719 19:7887533-7887555 GGGTGGGGAGGCAGAGAAGCTGG + Intergenic
1162322249 19:9977308-9977330 GGATGGGGGTGAATGGAAGCTGG - Intronic
1162524156 19:11197666-11197688 GGGTGGGGATGGAGAGACGCTGG + Intronic
1162927753 19:13938559-13938581 GGGTGGGGATGGAGGGATGGGGG + Intronic
1165928256 19:39341041-39341063 GGGAGGGTATGAAGGGTCACTGG - Intronic
1166321956 19:42024114-42024136 GGGTGGGTGTGATGGGAGCCTGG - Intronic
1166695467 19:44849063-44849085 GGGTGGGTATATAGAGAGGCTGG + Intronic
1168127012 19:54289854-54289876 GTGGGGGCATGAAGGGATGCTGG + Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926744834 2:16142664-16142686 TGAAGGGTATGAAGGAAAGCAGG + Intergenic
927158488 2:20236187-20236209 GGGTGGGGATGACAGGAAGCTGG + Intergenic
927428614 2:23007993-23008015 GGGTGGGGCTGAAGGGGAGAGGG + Intergenic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
928022624 2:27716038-27716060 GGGAGGGGAGGAAGGGAAGGGGG - Intergenic
928033276 2:27799210-27799232 TGATGGGTATGAAGTGTAGCTGG + Intronic
928756705 2:34535004-34535026 TGGTGGGGATTAAGGAAAGCTGG + Intergenic
929554338 2:42916020-42916042 GGGCTGTGATGAAGGGAAGCTGG + Intergenic
930366536 2:50446476-50446498 GGGAGGGAAGGAAGGGAGGCAGG - Intronic
930851511 2:55965936-55965958 AGGTGTGTGTGAAGGGAAGGAGG + Intergenic
932333749 2:70917496-70917518 TGGTGAGGATGCAGGGAAGCTGG - Intronic
932712911 2:74080912-74080934 GGAGGGGTAGGAAGGGAAACTGG + Intronic
934676710 2:96254443-96254465 AGGCGGGTCTGTAGGGAAGCAGG + Intronic
935571178 2:104661253-104661275 TGGTGGGTAGGTAGGGAAGGGGG + Intergenic
935699798 2:105801628-105801650 GGGTAGGTAAGAAGCCAAGCAGG - Intronic
935999357 2:108811123-108811145 GGGAGGGGAAGAAGGGAAGAAGG - Intronic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
937980408 2:127611407-127611429 GGGTGGACATGGGGGGAAGCAGG + Intronic
938191740 2:129289177-129289199 GGGTGAGAATGAAGGGACACGGG + Intergenic
939654141 2:144801841-144801863 GGGTGGGTATATAAGGAAGTAGG + Intergenic
940324428 2:152410652-152410674 GGGTGGGGGTGAAGGGATGGTGG - Intronic
940677872 2:156746872-156746894 GGGTGGATATTCTGGGAAGCAGG - Intergenic
941415817 2:165219788-165219810 TGGTGGGGATGACAGGAAGCAGG + Intergenic
941610975 2:167661906-167661928 GGGTGGGTTTGAAGACAAGTAGG + Intergenic
942330077 2:174814155-174814177 GGCTAGGTGTCAAGGGAAGCTGG + Intronic
944154886 2:196598260-196598282 GGGAGGGTAAGAGGGGAAGGGGG + Intergenic
944154926 2:196598341-196598363 GGGAGGGTAAGAGGGGAAGGGGG + Intergenic
944361749 2:198865332-198865354 GGGTGGGCAGGGAGGGCAGCTGG - Intergenic
944932341 2:204532622-204532644 GGGTGGATCTGAAGGGACGTAGG - Intergenic
944945176 2:204676126-204676148 GGGTGGTAATGAGGGGAAGGTGG + Intronic
945008968 2:205441511-205441533 TGGTGGGGAAGAAGGGTAGCAGG + Intronic
945265571 2:207888340-207888362 GTGTGTGTATGAAGAAAAGCAGG - Intronic
945363820 2:208926627-208926649 TGGTGAGTATGAAGAGAAGCTGG + Intergenic
946899937 2:224362321-224362343 AGGTGGGAAGGAAGGGAAGGAGG + Intergenic
948106069 2:235414685-235414707 GAGTGGGTATGAAGGGAACTGGG + Intergenic
948545152 2:238722964-238722986 GGCTGGGTTTGACTGGAAGCTGG - Intergenic
1168744072 20:221336-221358 GGGAGGGAATGGAGGGAAGGAGG + Intergenic
1168869023 20:1113347-1113369 GGGTGGCTGAGAAGGGAAGCAGG - Intronic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1170217680 20:13908877-13908899 GGGTATGTACAAAGGGAAGCTGG - Intronic
1171412630 20:24957135-24957157 GGGTAGGTAAGAGGGGGAGCAGG + Intronic
1171794844 20:29558748-29558770 GGCTGTGTCTGAAGGGCAGCAGG - Intergenic
1171853612 20:30325517-30325539 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1172149533 20:32780276-32780298 GGGTGGGGTGAAAGGGAAGCAGG - Intronic
1172245758 20:33443877-33443899 GGGTGGGTCAGAAGGGCGGCGGG + Exonic
1172383420 20:34515752-34515774 GGGAGGGTATGAAGGCAAGTGGG - Intergenic
1172397768 20:34621585-34621607 GGGTGAGTATGGAGGCAGGCAGG + Intronic
1172783732 20:37452227-37452249 GGGTGGGGAGGTGGGGAAGCTGG - Intergenic
1172821182 20:37735919-37735941 GGGATAGTATGAAGAGAAGCAGG + Intronic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1173819436 20:46011075-46011097 GGGAGAGAATGAAGGGAATCAGG - Intronic
1173870565 20:46339379-46339401 TAGTGGGTAGGAGGGGAAGCAGG + Intergenic
1173900789 20:46587434-46587456 TGGTGGGAAGGAAGGAAAGCGGG - Intronic
1175268408 20:57716579-57716601 TGCTGGGTTTGAGGGGAAGCAGG + Intergenic
1175345263 20:58268521-58268543 GGGTGGGAATGAAGAGGAGCGGG + Intergenic
1175625299 20:60484349-60484371 GGGTGGCCATGAAAGGAAGGAGG - Intergenic
1176947466 21:15000302-15000324 GGGTGGGTGAGAGGGGAAGGTGG + Intronic
1177497143 21:21903831-21903853 GGGAGGGAAGGAAGGGAAGGAGG + Intergenic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178512353 21:33216078-33216100 GGGTGGCTAAGGAGGGCAGCTGG + Intergenic
1179351985 21:40620501-40620523 GGGAGGGGAGGAAGGCAAGCAGG + Intronic
1179539067 21:42072484-42072506 GGGTGGGTATCCTGGGAAGCTGG + Intronic
1180735025 22:18010028-18010050 GGGAGGGGAGGGAGGGAAGCAGG + Intronic
1181138448 22:20786211-20786233 GGGTGGGTAGGAAGGGCAAGTGG - Intronic
1182109063 22:27710129-27710151 GGGTGTGAATGACGGGAAGTGGG + Intergenic
1182361326 22:29748113-29748135 TGGAGGGTGTGAAGAGAAGCAGG - Intronic
1182581080 22:31311757-31311779 GGGTGGGTATGAAAGAAGACTGG - Intergenic
1182762713 22:32735553-32735575 GGCTGGATTTGCAGGGAAGCTGG - Intronic
1182931433 22:34178182-34178204 GGGAGGGAAGGAAGGGAAGCAGG - Intergenic
1183111999 22:35657273-35657295 GGGGTGGGATGAAGGCAAGCGGG - Intronic
1183337650 22:37259813-37259835 GGTTGGGTAGGAAGGGGAGGGGG - Intergenic
1183394171 22:37561841-37561863 GGGCGGGTCTGAAGGAGAGCGGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184658318 22:45953134-45953156 CGGTGGCTGTGAGGGGAAGCCGG - Intronic
1184658327 22:45953166-45953188 CGGTGGCTGTGAGGGGAAGCCGG - Intronic
1184658366 22:45953342-45953364 CGGTGGCTGTGAGGGGAAGCTGG - Intronic
1184696393 22:46141487-46141509 GGATCAGTGTGAAGGGAAGCTGG - Intergenic
949753354 3:7379909-7379931 GGGTGATGATGAAGGGAAGGCGG - Intronic
950169976 3:10832214-10832236 GGGTGGGTTTGCAGGGCACCAGG - Intronic
950294327 3:11815271-11815293 GGGTGATAATGAAGGGAAGGTGG + Intronic
950616819 3:14166501-14166523 GGGTGGGGGTGAAGGGAGGGTGG - Intronic
950634783 3:14307234-14307256 GGGTGGGGATGCAGGGGAGGTGG + Intergenic
950725411 3:14913922-14913944 GTGTGGGGAAGAAGAGAAGCAGG - Intronic
952270803 3:31829599-31829621 GTGTGTCTATGAGGGGAAGCAGG + Intronic
952490202 3:33863409-33863431 GGGTGGGGATGAAGAGAGGGTGG - Intronic
952683243 3:36120213-36120235 GGGTAGGTATTGGGGGAAGCTGG + Intergenic
953631909 3:44625167-44625189 GGGTGGGCGTGCAGGGAAGGCGG + Intronic
953903717 3:46857767-46857789 AGGTGGGTAGGAAGGGAGGGAGG + Intergenic
954134105 3:48574261-48574283 GGCTGGGCCTGAAGGGAAGCCGG - Exonic
954433058 3:50481492-50481514 GGGTGGGCAGCAGGGGAAGCAGG + Intronic
955148027 3:56339395-56339417 GGGGAGGTATGAAGGGAACTGGG + Intronic
956436208 3:69236956-69236978 GGGTGGGTAGAAAGTGAAGAGGG - Intronic
957051596 3:75416068-75416090 GGGTTGGTGTGAAGGGCACCTGG + Intergenic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
959672551 3:108995726-108995748 GGGTGAATATGGAGGGAAACGGG + Intronic
959984945 3:112561898-112561920 GAGTGAGAAGGAAGGGAAGCCGG - Exonic
961885188 3:130092248-130092270 GGGTTGGTGTGAAGGGCACCTGG + Intronic
962053699 3:131846490-131846512 GAATGGGGATAAAGGGAAGCTGG - Intronic
962844736 3:139264217-139264239 GCGTGGGTATTAAGGCCAGCTGG + Intronic
962850035 3:139301511-139301533 CAGAGGGAATGAAGGGAAGCTGG - Intronic
963609196 3:147443807-147443829 GGTTGGGAATGAAAGGGAGCAGG - Intronic
965772197 3:172193139-172193161 AGGTGGGAAGGAAGGGAGGCAGG - Intronic
967974479 3:195025324-195025346 GGCTGGGTGTGAAGGCAAACTGG - Intergenic
968546116 4:1199885-1199907 GGGTGGGCATGAGAGGATGCAGG + Intronic
973015396 4:45131063-45131085 AAGTGGCAATGAAGGGAAGCTGG - Intergenic
974642147 4:64645060-64645082 GGGTGGAAATAAAGGGAAGATGG - Intergenic
974694024 4:65341045-65341067 GAGGAGGGATGAAGGGAAGCCGG - Intronic
975094967 4:70447062-70447084 GGGTGGGTGGGCAGGGAAGAGGG + Intronic
976890808 4:90045230-90045252 GGGTTGGTAGGAAGGGCAGAAGG - Intergenic
977285605 4:95102478-95102500 GGTCTGGTATGAAAGGAAGCAGG + Intronic
977443734 4:97101982-97102004 TGGTGAGTAAGAAGGGGAGCAGG - Intergenic
978459139 4:108930626-108930648 GTGTGGGAGAGAAGGGAAGCAGG + Intronic
979698494 4:123640796-123640818 GGGAGGGAAGGAAGGGAGGCAGG + Intergenic
981073487 4:140568919-140568941 GGGTGGGTAGGAGGGGACGCGGG - Intergenic
982274818 4:153628116-153628138 AGTTGGGGAGGAAGGGAAGCAGG - Intronic
982693121 4:158570650-158570672 GGGAGGGTAGGAGGGAAAGCTGG - Intronic
983387424 4:167082830-167082852 GGGAGGGAAGGAAGGGAAGAGGG + Intronic
984256965 4:177400869-177400891 GGGAGGGACTGAAGGGAAGATGG - Intergenic
984418162 4:179486899-179486921 GGGTGGCTATGGAAGGAGGCTGG + Intergenic
985033225 4:185813354-185813376 GGTTGGGGAGGAAGGGGAGCGGG - Intronic
985561064 5:586094-586116 GAGAGGGTAGGAAGGGAAGAAGG + Intergenic
986016204 5:3759464-3759486 GGGTTGGGGTGAAGGGGAGCTGG + Intergenic
987031500 5:13980533-13980555 GGGTGGGTTAGAAGTGAAGGGGG - Intergenic
988185901 5:27861612-27861634 GTGTGTGCATGAAGGGAAGGGGG - Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
989333525 5:40287986-40288008 GGGTGGGCTTGAAAGGAAGGTGG - Intergenic
992525111 5:77602091-77602113 GGGTGGGGATGAAGAGAGGTTGG - Intronic
992751382 5:79865848-79865870 GGTGGGGTCTGAAGGGCAGCTGG - Intergenic
992882890 5:81128128-81128150 TGGTGGGGAGGAAGGGAAGCGGG + Intronic
993453189 5:88097597-88097619 GGGTGGGCGTGAAGGTCAGCAGG - Intergenic
994334152 5:98544772-98544794 GGGGGGGTATGAAGAGAAGTTGG - Intergenic
994821774 5:104661387-104661409 GGGTTGTTATGAAGTGAATCTGG + Intergenic
995522885 5:113027485-113027507 AGGTGGGAATGAAGGGAAATTGG + Intronic
997234627 5:132265708-132265730 AGGTGGGTATGAGGTGAGGCTGG - Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998139790 5:139693324-139693346 GGGTGGGTCTGAAAAGGAGCAGG - Intergenic
998392675 5:141797429-141797451 GGGTGGGTGTGAGAAGAAGCAGG - Intergenic
999053169 5:148545742-148545764 GGAAGGGGGTGAAGGGAAGCTGG + Intronic
999264256 5:150256270-150256292 GGGTGGGGAAGAAGGCAGGCTGG - Intronic
999323201 5:150627169-150627191 GGGAGGGACTGAGGGGAAGCAGG + Intronic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
1000946432 5:167427831-167427853 GGGAGGGAAGGAAGGGAAGAAGG + Intronic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002211770 5:177603727-177603749 GGGTGGATCTGTAGGGGAGCGGG + Intronic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003773641 6:9335745-9335767 GGGAGGGTAGGGAGGGAAGCAGG - Intergenic
1004310407 6:14540329-14540351 TGGTGGGTTTGAAGGGAATGTGG + Intergenic
1004351359 6:14893071-14893093 GGTTGGGGATGGAGGGAAGGAGG + Intergenic
1004426938 6:15513136-15513158 GGGTGTGTCTGCAGGGAGGCCGG + Intronic
1004895253 6:20141799-20141821 CGGTGGGCATGAAGGGCAGCGGG + Intronic
1004975124 6:20957120-20957142 TGGAGGGTAGGAAGGGAAACAGG + Intronic
1005005717 6:21285555-21285577 GGCTGGGGATGGAAGGAAGCAGG - Intergenic
1006276503 6:33008681-33008703 AGGTGGGTGTGAGGGGAAACAGG + Intronic
1006806595 6:36793230-36793252 GGCAGGGGAGGAAGGGAAGCCGG + Intronic
1006971450 6:38049889-38049911 GGGTGGGTGTGAGGGGGAGGGGG - Intronic
1007834957 6:44667135-44667157 GGGAGAGGATGAAGGAAAGCAGG + Intergenic
1008610935 6:53183926-53183948 GGTTGGGGATGAGAGGAAGCTGG - Intergenic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010597180 6:77778152-77778174 GGGTGGGAAGGAAGGGAAAGGGG + Intronic
1012573544 6:100761896-100761918 GGGTGGGAATAAAGGGTAGTTGG - Intronic
1013739111 6:113262718-113262740 GAGAGGGTAGGAAGGGAAGGGGG + Intergenic
1014534702 6:122600787-122600809 GAGTAGGCATGCAGGGAAGCAGG + Intronic
1014992229 6:128094988-128095010 AGGTGAGTTTGAAGGGAAGGTGG + Intronic
1015790128 6:136957783-136957805 GGGTGGGTGGGAAGGGAGCCTGG - Intergenic
1015877237 6:137834906-137834928 GGGAGGGAAGGAAGGGAGGCAGG + Intergenic
1016318732 6:142819007-142819029 GGGAGGGAAAGAAGGGAGGCAGG + Intronic
1017557804 6:155591274-155591296 AGGTGGGAATGAAGAGAAGTTGG - Intergenic
1018010418 6:159665050-159665072 GGGGAGGCAGGAAGGGAAGCTGG + Intergenic
1018370930 6:163167799-163167821 GGGTTGGTTTGAAAGGAAGTGGG - Intronic
1018674496 6:166207146-166207168 TGGTGGGTCTTCAGGGAAGCCGG - Intergenic
1019608176 7:1920561-1920583 GGGCGGGGATGAACGGAGGCTGG + Intronic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1020129040 7:5549139-5549161 GGGAGGGAAGGAAGGGAAGAAGG + Intronic
1020487975 7:8742693-8742715 GGGTGGGATTGCAAGGAAGCAGG + Intronic
1022320090 7:29279913-29279935 TGGTGGGTAAGAAAAGAAGCAGG + Intronic
1022361538 7:29664181-29664203 TGGTGGGTATCCAGTGAAGCTGG + Intergenic
1022384549 7:29889097-29889119 TGGTTGGGATGGAGGGAAGCAGG - Intronic
1022388116 7:29920698-29920720 GGGTGGTTCAGCAGGGAAGCCGG - Intronic
1022665906 7:32410363-32410385 GGGCGGGTAGGAAGAGAAGGAGG + Intergenic
1022699851 7:32749544-32749566 TGGTGGGTATCCAGTGAAGCTGG - Intergenic
1022935803 7:35175248-35175270 TGGTGGGTATCCAGTGAAGCTGG - Intergenic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1024368569 7:48552947-48552969 GGGTGTGTAGGGAGGGAAGTGGG - Intronic
1027810120 7:82885671-82885693 GGGTAGGGATGAAGGGAAATGGG + Intronic
1028310469 7:89327000-89327022 GAATGAGTATGAAGGGAGGCAGG - Intronic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1029831764 7:103267984-103268006 TGGTGGGTATCCAGTGAAGCTGG - Intergenic
1031384715 7:121134452-121134474 GGGAGGGTAGGAAGGGAAGGAGG + Intronic
1032332719 7:130994933-130994955 GGGTGGGCGGGAATGGAAGCAGG - Intergenic
1032453095 7:132051592-132051614 TGGTGGGAATGAAGGGAAATAGG - Intergenic
1032777895 7:135134075-135134097 GGATGGGAAAGGAGGGAAGCAGG + Intronic
1032792084 7:135249880-135249902 TGTTGGGTATTAAGGGAAGCTGG + Intronic
1033263690 7:139865919-139865941 GGGAGGGAAGGAAGGGAAGAAGG + Intronic
1033644058 7:143287658-143287680 GGGTTGGTATGAAGGCCAGAAGG + Exonic
1033989068 7:147262493-147262515 GGAGGGGTATGAAAGGACGCAGG + Intronic
1034161973 7:149000744-149000766 GGGTGGGTAAACTGGGAAGCTGG - Intergenic
1034337538 7:150333185-150333207 GGGTGAGGATGAAAGGAAGAGGG + Intronic
1034491698 7:151396374-151396396 GGGTGGGCATGAGGGGAGTCAGG - Intronic
1035028986 7:155845053-155845075 GGGAGGTGAGGAAGGGAAGCAGG - Intergenic
1035162416 7:156960929-156960951 GGATTGGGATGAAGGGAAGGAGG + Intronic
1036020709 8:4842214-4842236 GTGTGGGAATTAAGGGAACCAGG + Intronic
1036707430 8:11055889-11055911 GCGGGGGTATGAAGGAAATCAGG - Intronic
1036999021 8:13695458-13695480 GGGTGGATGTGGAGGGATGCTGG + Intergenic
1037879808 8:22566991-22567013 GGCAGGGTCTGAAGGGAAGGAGG + Intronic
1037998425 8:23369829-23369851 GTGTGGCTCTGAAGGGAATCAGG + Intronic
1038072757 8:24035727-24035749 GGGAGGGCAAGAAGGGAGGCAGG + Intergenic
1038355111 8:26821740-26821762 GGGTGGGGCAGAAGGGAAGTGGG - Intronic
1039398502 8:37247653-37247675 GGGTTGCTCTGCAGGGAAGCAGG - Intergenic
1039431042 8:37525249-37525271 GGGTAGGGATGCAGAGAAGCTGG - Intergenic
1039734957 8:40321936-40321958 GGGTGGATAGGAAGAGAAGAGGG - Intergenic
1039914198 8:41847743-41847765 GGGTGCGTATGTGGGGAATCTGG - Intronic
1040492975 8:47941984-47942006 GCGTGGGCCTGCAGGGAAGCCGG - Intronic
1040892976 8:52336654-52336676 GGTTGGGTGAGATGGGAAGCGGG + Intronic
1041090961 8:54300301-54300323 GGGTGGGGATGGGGGGAAACCGG + Intergenic
1042402986 8:68370991-68371013 GGGTGGGTCTTAAGGGAAAGAGG + Intronic
1044942117 8:97354053-97354075 GGGTGGGTGTGAAGGGGATTTGG - Intergenic
1047510619 8:125512795-125512817 GGGAAGGTTTGAAGGGCAGCAGG + Intergenic
1048226363 8:132590198-132590220 GGGAGGCAATGGAGGGAAGCTGG + Intronic
1048332483 8:133480104-133480126 GGATGGGGAAGGAGGGAAGCTGG + Intronic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1049548706 8:143246612-143246634 GGCGGGGCATGAGGGGAAGCCGG + Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050495276 9:6234425-6234447 GACTGGGGATGAGGGGAAGCAGG - Intronic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052475700 9:28956638-28956660 GGGAGGGAAAGAAGGGAAGAAGG - Intergenic
1052773348 9:32709401-32709423 AGGTGAGTATGAAGGGTTGCAGG + Intergenic
1053295104 9:36907077-36907099 GGCTTGGTACCAAGGGAAGCAGG + Intronic
1053495777 9:38547051-38547073 GGGTGGGTAGGGTGGGAAGTAGG - Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1055029358 9:71757755-71757777 GGTTTGGTTTGAGGGGAAGCAGG + Intronic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1057503561 9:95614980-95615002 GGGTGCTTATGCAGGGAGGCGGG + Intergenic
1057611724 9:96550207-96550229 AGGTGGGTAGGAAGGGAAGAGGG - Intronic
1057675711 9:97134566-97134588 GGGTGGGTAGGGTGGGAAGTAGG - Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057959144 9:99438124-99438146 GGGAGGGGGTGAAGGGAGGCTGG - Intergenic
1058287118 9:103192014-103192036 GGGTGGGAATGAAGAGAAGCTGG + Intergenic
1059248939 9:112871082-112871104 GGCTGGCTCTGAAGGGAGGCAGG + Exonic
1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG + Intronic
1060025605 9:120168228-120168250 GGGTGGGTATGCAGAGAAGAGGG - Intergenic
1060298145 9:122356838-122356860 TGGAGGGGATGAAGGGACGCAGG + Intergenic
1061255610 9:129453236-129453258 GGATGGGGATGAAGGGATGGAGG + Intergenic
1061739716 9:132692456-132692478 GGGTGGGAGTGAGGGGAAACAGG - Exonic
1062035061 9:134379313-134379335 GGGTGGGGATGAAGGAGGGCTGG + Intronic
1186107097 X:6219393-6219415 GGGAGGGAATGAAGGAAAGAAGG - Intronic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186335251 X:8579910-8579932 TGGTAGGTAGGAAGGGAAGTAGG - Intronic
1187503984 X:19864036-19864058 GGATGGCTGTGAAGGGGAGCAGG - Intronic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1189126757 X:38456312-38456334 GGGTGGGGACGAGGGGAAGGAGG - Intronic
1189483407 X:41410487-41410509 GGTTGGGAATGAGGAGAAGCAGG + Intergenic
1190337297 X:49270127-49270149 GGATGGGGATGAAGGGGAGGAGG + Exonic
1191726826 X:64290599-64290621 TGGTGGGTATGAGGGGGAGGTGG - Intronic
1194524129 X:94956624-94956646 GAGTGGGGATGAAGAGAGGCTGG + Intergenic
1196845844 X:119896359-119896381 GGGTGGGTAGGAAGAGATGGGGG - Intronic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1196886580 X:120251384-120251406 GGGGGGGGATGAAGCGAAGCAGG - Intronic
1199880520 X:151970913-151970935 GGAAGGGGATGAAGGGAAGGAGG + Intronic
1199941049 X:152628209-152628231 GGGTGGGAATGACAGGAAGGAGG + Intergenic
1201336573 Y:12887879-12887901 GGGAGGGAAGGAAGGGAAGGAGG - Intergenic