ID: 1090807151

View in Genome Browser
Species Human (GRCh38)
Location 11:130209777-130209799
Sequence GGCTCCCTCTGTTTCGGGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090807148_1090807151 -7 Left 1090807148 11:130209761-130209783 CCAGGCGTGTACACAAGGCTCCC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1090807151 11:130209777-130209799 GGCTCCCTCTGTTTCGGGACTGG 0: 1
1: 0
2: 1
3: 12
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090807151 Original CRISPR GGCTCCCTCTGTTTCGGGAC TGG Exonic