ID: 1090807696

View in Genome Browser
Species Human (GRCh38)
Location 11:130212669-130212691
Sequence CTGGACTGCCATCCTCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090807696_1090807703 15 Left 1090807696 11:130212669-130212691 CCTTGCTGAGGATGGCAGTCCAG No data
Right 1090807703 11:130212707-130212729 GAGAGGCCAGAGGCCTGCGTAGG No data
1090807696_1090807697 -8 Left 1090807696 11:130212669-130212691 CCTTGCTGAGGATGGCAGTCCAG No data
Right 1090807697 11:130212684-130212706 CAGTCCAGACCTGCAGCAGCTGG No data
1090807696_1090807698 -7 Left 1090807696 11:130212669-130212691 CCTTGCTGAGGATGGCAGTCCAG No data
Right 1090807698 11:130212685-130212707 AGTCCAGACCTGCAGCAGCTGGG No data
1090807696_1090807702 5 Left 1090807696 11:130212669-130212691 CCTTGCTGAGGATGGCAGTCCAG No data
Right 1090807702 11:130212697-130212719 CAGCAGCTGGGAGAGGCCAGAGG No data
1090807696_1090807700 -2 Left 1090807696 11:130212669-130212691 CCTTGCTGAGGATGGCAGTCCAG No data
Right 1090807700 11:130212690-130212712 AGACCTGCAGCAGCTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090807696 Original CRISPR CTGGACTGCCATCCTCAGCA AGG (reversed) Intergenic
No off target data available for this crispr