ID: 1090807697

View in Genome Browser
Species Human (GRCh38)
Location 11:130212684-130212706
Sequence CAGTCCAGACCTGCAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090807695_1090807697 -5 Left 1090807695 11:130212666-130212688 CCTCCTTGCTGAGGATGGCAGTC No data
Right 1090807697 11:130212684-130212706 CAGTCCAGACCTGCAGCAGCTGG No data
1090807693_1090807697 0 Left 1090807693 11:130212661-130212683 CCATTCCTCCTTGCTGAGGATGG No data
Right 1090807697 11:130212684-130212706 CAGTCCAGACCTGCAGCAGCTGG No data
1090807691_1090807697 14 Left 1090807691 11:130212647-130212669 CCAGCAGGCTAGAGCCATTCCTC No data
Right 1090807697 11:130212684-130212706 CAGTCCAGACCTGCAGCAGCTGG No data
1090807696_1090807697 -8 Left 1090807696 11:130212669-130212691 CCTTGCTGAGGATGGCAGTCCAG No data
Right 1090807697 11:130212684-130212706 CAGTCCAGACCTGCAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090807697 Original CRISPR CAGTCCAGACCTGCAGCAGC TGG Intergenic
No off target data available for this crispr