ID: 1090807700

View in Genome Browser
Species Human (GRCh38)
Location 11:130212690-130212712
Sequence AGACCTGCAGCAGCTGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090807695_1090807700 1 Left 1090807695 11:130212666-130212688 CCTCCTTGCTGAGGATGGCAGTC No data
Right 1090807700 11:130212690-130212712 AGACCTGCAGCAGCTGGGAGAGG No data
1090807696_1090807700 -2 Left 1090807696 11:130212669-130212691 CCTTGCTGAGGATGGCAGTCCAG No data
Right 1090807700 11:130212690-130212712 AGACCTGCAGCAGCTGGGAGAGG No data
1090807691_1090807700 20 Left 1090807691 11:130212647-130212669 CCAGCAGGCTAGAGCCATTCCTC No data
Right 1090807700 11:130212690-130212712 AGACCTGCAGCAGCTGGGAGAGG No data
1090807693_1090807700 6 Left 1090807693 11:130212661-130212683 CCATTCCTCCTTGCTGAGGATGG No data
Right 1090807700 11:130212690-130212712 AGACCTGCAGCAGCTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090807700 Original CRISPR AGACCTGCAGCAGCTGGGAG AGG Intergenic
No off target data available for this crispr