ID: 1090807701

View in Genome Browser
Species Human (GRCh38)
Location 11:130212693-130212715
Sequence TGGCCTCTCCCAGCTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090807701_1090807703 -9 Left 1090807701 11:130212693-130212715 CCTGCAGCAGCTGGGAGAGGCCA No data
Right 1090807703 11:130212707-130212729 GAGAGGCCAGAGGCCTGCGTAGG No data
1090807701_1090807706 22 Left 1090807701 11:130212693-130212715 CCTGCAGCAGCTGGGAGAGGCCA No data
Right 1090807706 11:130212738-130212760 GACCAGCCTTTCCTTCACCCAGG No data
1090807701_1090807709 28 Left 1090807701 11:130212693-130212715 CCTGCAGCAGCTGGGAGAGGCCA No data
Right 1090807709 11:130212744-130212766 CCTTTCCTTCACCCAGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090807701 Original CRISPR TGGCCTCTCCCAGCTGCTGC AGG (reversed) Intergenic
No off target data available for this crispr