ID: 1090807703

View in Genome Browser
Species Human (GRCh38)
Location 11:130212707-130212729
Sequence GAGAGGCCAGAGGCCTGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090807701_1090807703 -9 Left 1090807701 11:130212693-130212715 CCTGCAGCAGCTGGGAGAGGCCA No data
Right 1090807703 11:130212707-130212729 GAGAGGCCAGAGGCCTGCGTAGG No data
1090807693_1090807703 23 Left 1090807693 11:130212661-130212683 CCATTCCTCCTTGCTGAGGATGG No data
Right 1090807703 11:130212707-130212729 GAGAGGCCAGAGGCCTGCGTAGG No data
1090807695_1090807703 18 Left 1090807695 11:130212666-130212688 CCTCCTTGCTGAGGATGGCAGTC No data
Right 1090807703 11:130212707-130212729 GAGAGGCCAGAGGCCTGCGTAGG No data
1090807696_1090807703 15 Left 1090807696 11:130212669-130212691 CCTTGCTGAGGATGGCAGTCCAG No data
Right 1090807703 11:130212707-130212729 GAGAGGCCAGAGGCCTGCGTAGG No data
1090807699_1090807703 -4 Left 1090807699 11:130212688-130212710 CCAGACCTGCAGCAGCTGGGAGA No data
Right 1090807703 11:130212707-130212729 GAGAGGCCAGAGGCCTGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090807703 Original CRISPR GAGAGGCCAGAGGCCTGCGT AGG Intergenic
No off target data available for this crispr