ID: 1090816087

View in Genome Browser
Species Human (GRCh38)
Location 11:130297419-130297441
Sequence CTGCTTGTGCAGAGGTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090816087_1090816092 5 Left 1090816087 11:130297419-130297441 CCAACTTACCTCTGCACAAGCAG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1090816092 11:130297447-130297469 TTTATATATGTCTTGGTATGGGG 0: 1
1: 0
2: 2
3: 34
4: 339
1090816087_1090816090 3 Left 1090816087 11:130297419-130297441 CCAACTTACCTCTGCACAAGCAG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1090816090 11:130297445-130297467 ACTTTATATATGTCTTGGTATGG 0: 1
1: 0
2: 0
3: 15
4: 192
1090816087_1090816089 -2 Left 1090816087 11:130297419-130297441 CCAACTTACCTCTGCACAAGCAG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1090816089 11:130297440-130297462 AGTTAACTTTATATATGTCTTGG 0: 1
1: 0
2: 3
3: 20
4: 265
1090816087_1090816091 4 Left 1090816087 11:130297419-130297441 CCAACTTACCTCTGCACAAGCAG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1090816091 11:130297446-130297468 CTTTATATATGTCTTGGTATGGG 0: 1
1: 0
2: 2
3: 17
4: 313
1090816087_1090816094 15 Left 1090816087 11:130297419-130297441 CCAACTTACCTCTGCACAAGCAG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1090816094 11:130297457-130297479 TCTTGGTATGGGGTTGAATTGGG 0: 1
1: 0
2: 1
3: 10
4: 230
1090816087_1090816093 14 Left 1090816087 11:130297419-130297441 CCAACTTACCTCTGCACAAGCAG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1090816093 11:130297456-130297478 GTCTTGGTATGGGGTTGAATTGG 0: 1
1: 0
2: 0
3: 15
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090816087 Original CRISPR CTGCTTGTGCAGAGGTAAGT TGG (reversed) Intronic
901012583 1:6209957-6209979 CAGGCTGTGCAGAGGTGAGTTGG + Exonic
901813758 1:11782320-11782342 CTGCTACTGCAGAGGTGGGTGGG + Exonic
901835081 1:11918938-11918960 CTGCATGGACAGAAGTAAGTGGG + Intergenic
906078716 1:43069830-43069852 CTGAATGTGCAGAGGAATGTAGG + Intergenic
906977550 1:50591783-50591805 CTGTTAGTGCAGAAGAAAGTCGG - Intronic
909077827 1:71074059-71074081 CTGTTTGTGGAGAAGTAATTAGG - Intronic
909141705 1:71875393-71875415 CTGCTTTTACAGAGAGAAGTAGG - Intronic
910806751 1:91195790-91195812 CTGATAGAGAAGAGGTAAGTAGG + Intergenic
915946864 1:160159109-160159131 ATCCTTGTGCAGAGATAAGCCGG - Exonic
919597117 1:199578046-199578068 CTGCTTGGGAAGAGGTAAAATGG + Intergenic
919615095 1:199796966-199796988 CTGCTTGTGGGGAAGTAAATTGG - Intergenic
920248872 1:204608888-204608910 CTGCTTGTGGGGAGGTCACTAGG + Intergenic
920336635 1:205249445-205249467 CTGCTGGTTCAGAGGTGGGTGGG + Intronic
920381688 1:205538257-205538279 CTGCTTGTGGAGAAGTGGGTGGG - Intergenic
922197826 1:223375205-223375227 CAGCTTGTGCAAAGGTCAGGAGG + Intergenic
922476392 1:225909755-225909777 CTGCTTGTGCCCAGGTAGGGTGG - Intronic
1062841706 10:678284-678306 CTGCTTTTCCAGAGGAAAGCTGG - Intronic
1074916117 10:117956786-117956808 ATGCTTGTGAAAAGCTAAGTGGG - Intergenic
1075166225 10:120070618-120070640 CTGCGTGTGCAGAGTTGAGACGG + Intergenic
1078594536 11:12674821-12674843 CTCCCTGGGCCGAGGTAAGTTGG + Exonic
1081123391 11:39292966-39292988 CAGCTTGTCAAGAAGTAAGTGGG - Intergenic
1081280206 11:41200552-41200574 CTGTTTTTGCAGAAGTAGGTAGG - Intronic
1082106690 11:48228887-48228909 CTGCTTGCGCAGAGGTGTGGAGG + Intergenic
1082185195 11:49171186-49171208 CTGAGTGGGCAGAGGTTAGTTGG - Exonic
1082777097 11:57254196-57254218 CAGCTTGTGCAGAGATCACTTGG + Intergenic
1083880049 11:65543883-65543905 CTGCATGAGCAGAAGAAAGTGGG - Intronic
1084913100 11:72407262-72407284 CTGCTTGTGGAAGGGTCAGTGGG - Intronic
1084921645 11:72475590-72475612 CTGGATGTGCAGATGTCAGTTGG + Intergenic
1085662433 11:78381358-78381380 CTGCTTGACCACAGGTTAGTTGG - Intronic
1086681137 11:89674156-89674178 CTGAGTGGGCAGAGGTTAGTTGG + Intergenic
1086949531 11:92877353-92877375 CTGGTTGTGCAGAGGGAAGGTGG - Intronic
1088540760 11:110911273-110911295 CTGCTGGTGCAGAGGGGAGAGGG + Intergenic
1088641982 11:111881398-111881420 CTGCCTGTGGAAAGGCAAGTGGG + Intronic
1088695857 11:112365412-112365434 CTGGTTGTGCAGCTGTATGTGGG + Intergenic
1088776101 11:113084781-113084803 CTGCTTGGGCAGAAGTTAGATGG - Intronic
1089524833 11:119090054-119090076 CTGCCAGAGAAGAGGTAAGTGGG + Exonic
1090135293 11:124191600-124191622 CTGATGGTGCAGAGGTCAGTGGG - Intergenic
1090816087 11:130297419-130297441 CTGCTTGTGCAGAGGTAAGTTGG - Intronic
1091428029 12:408528-408550 CTGCTTTTGGAGAGGGGAGTGGG + Intronic
1093102008 12:15038671-15038693 CAGCTTGTGCAGAGCTCAGAGGG - Intergenic
1094038243 12:26093798-26093820 CTGCATGTGCAGAGGTGGGCAGG + Intergenic
1097282196 12:57852009-57852031 CTGCCTGTGCAAAGGTAGGGAGG - Intergenic
1103119656 12:118371249-118371271 CTTCTTGTGGAGGGGGAAGTGGG + Intronic
1104237442 12:126952792-126952814 CTGCATCTGCAGAGATAAGCAGG - Intergenic
1110422336 13:75326641-75326663 CTGCTTATCCAAAGATAAGTGGG - Intronic
1112376584 13:98847979-98848001 CTGGTTCTGCACAGGAAAGTGGG + Intronic
1116206602 14:41875220-41875242 ATGCATGTGCAGAAGTAAGTGGG - Intronic
1117183691 14:53217876-53217898 CTGCTTGTGGAGAGGTGTGGCGG - Intergenic
1119415739 14:74468051-74468073 CTCCCTGTGCAGAGGGAAGCTGG + Intergenic
1120642885 14:87037018-87037040 CTTCTTGTGCAAAATTAAGTTGG + Intergenic
1121664190 14:95659322-95659344 CAGTTTGTGCAGGGCTAAGTGGG + Intergenic
1124162518 15:27285848-27285870 CTACTTGAGCAGAAGTAAGGTGG - Intronic
1125747162 15:42004929-42004951 CTGCTGGAGGAGAGGTGAGTAGG - Exonic
1126199273 15:45967313-45967335 CTGGTTGTGCATAGGCAGGTGGG + Intergenic
1126334154 15:47568103-47568125 CTGCTGGTGGAGATGTAACTTGG + Intronic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1127269556 15:57388214-57388236 CTGATTCTGGAGAGGTGAGTAGG + Intronic
1127655678 15:61053391-61053413 CTGCCTGTCCAGATGTAATTAGG + Intronic
1129047608 15:72750321-72750343 CAGATTATGCAGAGGTGAGTTGG - Intergenic
1129676680 15:77635423-77635445 CAGCTCATGCAGAGGTAACTGGG - Intronic
1129943987 15:79523597-79523619 CTTCTTGTGCAGAGGTGACAAGG - Intergenic
1131512636 15:93057673-93057695 CAGCTTCTGCAGAGGTGACTTGG - Intronic
1132064903 15:98722785-98722807 CTGCCTTTGCAGAGGTCTGTGGG + Intronic
1134818606 16:17227325-17227347 CTGCATGTGCAAAGGTATGGTGG + Intronic
1138751861 16:59432049-59432071 GTGCTTGTGAAGAGGTTAATGGG - Intergenic
1142995445 17:3757346-3757368 CAGCATGTGCAGAGGTGAGGAGG - Intronic
1146118822 17:30170876-30170898 CTGCTGGTGCAGATGTAGGCTGG - Intronic
1149493535 17:57102069-57102091 CAGCCTGTGCAGAGGTACGTGGG + Intronic
1150343915 17:64389444-64389466 GTGCTTGTACAAAGGGAAGTGGG - Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151760819 17:76101792-76101814 CTGCTTGTGCACAGGGATGATGG + Exonic
1156887819 18:42156093-42156115 CTGCATGTGCTAAGGAAAGTTGG + Intergenic
1158488338 18:57888181-57888203 CTTCTGGGGCAAAGGTAAGTAGG + Intergenic
1159117642 18:64133707-64133729 CTGCTCCTGAAGAAGTAAGTAGG - Intergenic
1159681461 18:71357626-71357648 CTGCTGGTGCATAGCTAAGTAGG - Intergenic
1160826040 19:1081051-1081073 CTGAGTGTGAAGAGGTGAGTGGG + Exonic
1161394311 19:4037257-4037279 CTGCTCTTGCAGAGAGAAGTGGG + Intronic
1164011768 19:21209922-21209944 CTGCTTGTGCAGAGTGAGGCTGG + Intergenic
1166148580 19:40853935-40853957 GTGCATGTGCAGACATAAGTTGG - Intronic
1166152719 19:40885718-40885740 GTGCATGTGCAGACATAAGTTGG - Intronic
1166162287 19:40963577-40963599 GTGCTTGGGCAGACATAAGTTGG + Intergenic
1166177457 19:41084927-41084949 GTGCATGTGCAGACATAAGTTGG + Intergenic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
928388002 2:30885790-30885812 CTGATGGTGAAGAGGGAAGTTGG + Intergenic
928435027 2:31249348-31249370 CTGCATGGGCAGAGGTAACCTGG - Intronic
935148622 2:100413864-100413886 CTGGTTAAGCAGAGTTAAGTGGG - Intronic
936741585 2:115518002-115518024 CTGCATGTGCAGAGATAACATGG + Intronic
937355438 2:121195413-121195435 CTGCTTGCCCAGGGGTAAGCTGG - Intergenic
937566049 2:123290241-123290263 CTGTGTGTGCAGAGTTAACTGGG - Intergenic
937984995 2:127634413-127634435 CTGCTGGGACAGAGGTAGGTGGG + Intronic
938111792 2:128572742-128572764 GGGCTTGTGCAGAGGAAGGTGGG + Intergenic
939004199 2:136766363-136766385 CTGTTTGTGGAGAGGAAACTGGG + Intronic
941960596 2:171249672-171249694 CTGCTTCTGAAGTGGGAAGTAGG - Intergenic
943066194 2:183089299-183089321 CTGCCTGTCCAGAGGTATTTTGG - Intronic
945907933 2:215615268-215615290 CTGCTTGTGGGGAGGTGAGGAGG - Intergenic
947138896 2:227002448-227002470 CTGCTTGGGCAGTGGTCAGTGGG - Intergenic
948125704 2:235563425-235563447 CTGCCTGGGCAGAGGAAAGTGGG - Intronic
948463623 2:238141987-238142009 CAGCTTGTGCACAGGCAAGGAGG + Intronic
1168961880 20:1875649-1875671 CTGCATGAGCAAAGGTAAGGAGG - Intergenic
1170128579 20:12993395-12993417 TTGCTTGTGCCTAGCTAAGTAGG - Intergenic
1170847430 20:19974368-19974390 CTGCCTTTTCACAGGTAAGTTGG - Intronic
1172449558 20:35012370-35012392 CTGCGTGTGCACAGGAAACTGGG - Intronic
1173849297 20:46207757-46207779 CAGCTTGTGCAGAGGTATACAGG - Intronic
1179325011 21:40333898-40333920 CTGCTTAAGCAAAGGTAATTTGG + Intronic
1179554207 21:42162302-42162324 ATGGCTGTGCAGGGGTAAGTTGG + Intergenic
1180839293 22:18951458-18951480 ATGCTTGTGCACACGTCAGTGGG - Intergenic
1181108717 22:20589421-20589443 CTGCTTGTGGAGGGGGACGTGGG + Intergenic
1182086780 22:27566398-27566420 CTACTTGTGGAGAGGTCAGCTGG - Intergenic
1182365502 22:29776108-29776130 CTGCTTGCTCAGAGTTATGTGGG - Intergenic
1184188237 22:42878554-42878576 CTCCTAGTGAAGAGGTAATTTGG + Intronic
1184278664 22:43425196-43425218 CCGCATGTGCAGATGTAAGTGGG + Exonic
1184445436 22:44544408-44544430 CTGATGATGCAGAGGTAAGAGGG - Intergenic
951033667 3:17909322-17909344 CTGCTGGTGCAGAGGCATTTGGG + Intronic
951767266 3:26214283-26214305 GTGGTTGTTCAGAGGTAAGGAGG + Intergenic
952344578 3:32471767-32471789 CTGCTTGCTCAGAGGTGGGTGGG - Intronic
957378974 3:79399359-79399381 CAGCTTGTTCAGAAGTCAGTGGG - Intronic
959489039 3:106965157-106965179 ATACATGTGCAGAGGTAAGAAGG + Intergenic
960621498 3:119641218-119641240 GTGCTTGTGGAGATGTAAATTGG + Intronic
961446964 3:126985436-126985458 CTGGCTGTGCAGAGGGCAGTAGG - Intergenic
962946641 3:140176961-140176983 CTGCTTGGGCAGAGAAAAGGGGG + Intronic
966236919 3:177712065-177712087 CAGCTTGTGAAGAGTTAAGTAGG - Intergenic
969560807 4:7946671-7946693 CTGCTTGTGCTGAGGGGAGGTGG - Intergenic
969605776 4:8201595-8201617 CTGCTTGTGCAGTGGTGGCTGGG + Intronic
973258585 4:48137905-48137927 CAGCTTGAGCAAAGGTAAGGAGG - Intronic
977035955 4:91953819-91953841 CTGTTTATGAAAAGGTAAGTTGG - Intergenic
978704096 4:111684493-111684515 CTGCGTGGGCAGACCTAAGTGGG + Intergenic
978708021 4:111740225-111740247 CTGCTTCTGCACAGGCCAGTAGG + Intergenic
992599410 5:78383128-78383150 CTGTTTTTGCAGGAGTAAGTTGG + Intronic
997892913 5:137690873-137690895 GTGCTTGAGCAGGGGTAAGAAGG + Intronic
998952878 5:147409731-147409753 CTGCTGGTGCAGAGGTTCATAGG - Intronic
1001673321 5:173492163-173492185 CTGCTTGTGCTGAGGACAGGGGG + Intergenic
1003447239 6:6195788-6195810 TTGTTTTTGCAGAGGTAAGCAGG - Exonic
1006331606 6:33395337-33395359 CTGATGGTGCAGAGGTGAGAAGG + Intronic
1007503505 6:42316462-42316484 CTGCTTGTGCACACATAAGCAGG - Intronic
1007825584 6:44598312-44598334 CTGCTTTTTCAGAGGTGACTAGG + Intergenic
1012180240 6:96143774-96143796 TTGTTTGCACAGAGGTAAGTGGG + Intronic
1014088418 6:117373667-117373689 CTGCTTGTGCGGAGGTGTGGAGG - Intronic
1014441646 6:121480372-121480394 CAGCGTGTGAAAAGGTAAGTTGG - Intergenic
1014485000 6:121987554-121987576 CTGCTTGTGGAAGTGTAAGTTGG - Intergenic
1016507847 6:144804519-144804541 CTGTTTGTACAGAGGTGACTGGG + Intronic
1017983828 6:159425294-159425316 CTGCTTATGCAGAGCAAAGGAGG - Intergenic
1019823308 7:3262524-3262546 CTGCGTGTGCAGTGGTTGGTGGG + Intergenic
1020963174 7:14831542-14831564 CTGCTTGTGCAGATGTGACCTGG + Intronic
1023926140 7:44671221-44671243 CTGCTTGTGCAGAGATCACATGG + Intronic
1025812644 7:64884929-64884951 CTGCCTGAGCAGAGGAAAATGGG - Intronic
1028922408 7:96322287-96322309 CGGCGTGGGCAGAGGTAACTTGG + Intergenic
1031135755 7:117882429-117882451 GTGCTGGGGCAGAGGGAAGTGGG + Intergenic
1041044088 8:53875537-53875559 TTGCTTCTGCAGAGATAACTGGG - Intronic
1041358970 8:57030239-57030261 CAGTTTGTGCAGAGGTGACTGGG - Intergenic
1041705476 8:60842039-60842061 CTGCTTGTCTATGGGTAAGTAGG + Exonic
1044460129 8:92434480-92434502 CTACTTGGGCAGAGCTAAGCAGG - Intergenic
1045914276 8:107447624-107447646 CTGCCTGTGCAGTTTTAAGTGGG - Intronic
1047276982 8:123413275-123413297 CCAATTGTGCAGAGGTAATTTGG - Intronic
1048325552 8:133436446-133436468 TTGCTTGTGCAGTGGTAGGAAGG + Intergenic
1048727214 8:137400374-137400396 CTGCTTGTGCAGAGCCTAGAGGG + Intergenic
1048764747 8:137831792-137831814 CTGCTGGAGCACAGGTATGTGGG - Intergenic
1050842862 9:10174369-10174391 CAGCCTGTGCAGAGGTCACTTGG - Intronic
1053355058 9:37438532-37438554 ATGCTTCAGCAGAGGTAAGCGGG + Exonic
1053363764 9:37508426-37508448 CTGCTTGGGTAGAGGTCAGCTGG + Intergenic
1055712636 9:79080942-79080964 CTACTTGGGGAGAGGTAAGAGGG + Intergenic
1062712279 9:137982714-137982736 TTGCTAGTGCAGAGAAAAGTTGG + Intronic
1186096396 X:6107347-6107369 CTGCTTGGGGAGTGCTAAGTAGG - Intronic
1190753482 X:53381445-53381467 CAGCATGTGCAGAGGCAAGGAGG - Intronic
1192209503 X:69118795-69118817 CTGCTGGTGGACAGGGAAGTGGG + Intergenic
1193129871 X:77908479-77908501 ATGCTTGTGCATTGGTAAGGAGG + Intergenic
1193880775 X:86918385-86918407 CTGCTCATGAAGAGGTAAATAGG - Intergenic
1194173524 X:90618139-90618161 CTGCTTGTGAGGAGGTATGGAGG - Intergenic
1195853024 X:109303730-109303752 ATGCTTGTGGAAAGGGAAGTAGG + Intergenic
1196438452 X:115695384-115695406 GTGTTTGGGCAGAGGTAGGTGGG - Intergenic
1196465844 X:115970541-115970563 CTGTTTGGGCAGAGGTGGGTGGG + Intergenic
1196487187 X:116225776-116225798 CTGCTTGTGGAGAGGTACATTGG + Intergenic
1196804235 X:119570598-119570620 CTGCTTCTGCTGAGGAATGTGGG + Intergenic
1199983447 X:152933827-152933849 CTGGGTGTGCTGAGGGAAGTAGG - Intronic
1201782797 Y:17741956-17741978 CTGCTTGAGCAGAGGTCATGGGG - Intergenic
1201818756 Y:18164031-18164053 CTGCTTGAGCAGAGGTCATGGGG + Intergenic
1201901443 Y:19048607-19048629 CTGCCTGGGCAAAGGTAAGATGG - Intergenic