ID: 1090816439

View in Genome Browser
Species Human (GRCh38)
Location 11:130301082-130301104
Sequence GGGTGATAACAGATGGTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090816439 Original CRISPR GGGTGATAACAGATGGTATA AGG Intronic
901113215 1:6816308-6816330 GGGGGAAGACAGATGGTAAATGG - Intronic
902099051 1:13970186-13970208 GGCTGAGAACAGATGGTATTTGG - Intergenic
904514386 1:31042576-31042598 AGCTCTTAACAGATGGTATAAGG + Intronic
907561221 1:55390138-55390160 GAGTGAGAACATATGGTATTTGG + Intergenic
909303889 1:74047634-74047656 GTGTGCTCACAGATGGTAGAGGG - Intronic
909504524 1:76373106-76373128 TTGTGATAACAGATGGTAACAGG + Intronic
909682136 1:78303653-78303675 GGGTGATCAGAGATGATATCAGG - Intergenic
911212059 1:95152194-95152216 GAATGTTAACAGATGCTATAAGG + Intronic
911565949 1:99463817-99463839 GGGTGATATAAGAAGGTAAATGG + Intergenic
916184741 1:162119925-162119947 AGATGGTAACAGTTGGTATATGG + Intronic
916612129 1:166402518-166402540 GGGTGAGAACACATGGTGTTTGG + Intergenic
917292635 1:173487139-173487161 TGGTGATAACAGGTGCTACAGGG + Intronic
918637071 1:186789632-186789654 GTGTGAGGACAGAGGGTATATGG - Intergenic
919226943 1:194716340-194716362 AAGTGATAACATATGGTATTTGG + Intergenic
922526896 1:226310659-226310681 GGGTGCTAGCAGCTAGTATAAGG - Intergenic
922911319 1:229220248-229220270 GGTAGATGACAGATGGCATATGG - Intergenic
923089796 1:230731332-230731354 GTGTGATAACAGATGGAAGGGGG - Intergenic
1064923968 10:20549945-20549967 GTGTGATAGCAGATGTAATAGGG + Intergenic
1065894736 10:30153485-30153507 GGGTGACAACAGCTGTTACAAGG - Intergenic
1066976949 10:42377855-42377877 GGGTGATAAAAGATTTTAAATGG - Intergenic
1067525597 10:47036510-47036532 AAGTGATAACAGATGGGAAAAGG - Intergenic
1070524700 10:77285683-77285705 GGGTGTTACCACATGGCATAGGG + Intronic
1071020181 10:81044708-81044730 AGGTGAGAACATATGGTATTTGG + Intergenic
1073495522 10:103887584-103887606 TGCTGATAAAAGATGTTATAAGG - Intronic
1076743198 10:132498259-132498281 AGATGGTCACAGATGGTATATGG - Intergenic
1078484767 11:11711519-11711541 GAGTGAGAACATATGGTATTTGG + Intergenic
1078641214 11:13098441-13098463 GGGTCAGAACAGATGGTAGTGGG + Intergenic
1081759130 11:45564762-45564784 GGATGAGACCAGATGGTATAGGG + Intergenic
1082789003 11:57334544-57334566 GGGAGTTAACAGAAGGTATCTGG - Exonic
1083538019 11:63490072-63490094 GGGTGATAACAGATGGTACTGGG - Intronic
1087869985 11:103281068-103281090 GGGTGTCAAGGGATGGTATATGG + Intronic
1088042318 11:105402196-105402218 AAGTGATAACACATGGTATTTGG + Intergenic
1089702332 11:120253005-120253027 GGGTGGTAAAAGATGGCTTATGG - Intronic
1090735656 11:129610374-129610396 AGGTGTCAACAGATGGGATATGG + Intergenic
1090816439 11:130301082-130301104 GGGTGATAACAGATGGTATAAGG + Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1092834930 12:12478297-12478319 AGCTGATAAGAGATGGTATGGGG + Intronic
1093418610 12:18949090-18949112 GAGTGAGAACATATGGTATTTGG - Intergenic
1093654540 12:21679643-21679665 TGATGATCACAGAAGGTATATGG + Intronic
1094279234 12:28716950-28716972 GAGTGATAAAACATGGTATTTGG - Intergenic
1094793682 12:33945278-33945300 GAGTGATAACAGATGGATCAGGG + Intergenic
1097524764 12:60718125-60718147 GGTTGATATCATATAGTATATGG - Intergenic
1098221837 12:68278358-68278380 GGGGGAAAAAAGATGGTTTAGGG + Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1100792926 12:98150349-98150371 GGGTGATAACAGGGGTTATCAGG + Intergenic
1105922219 13:24973747-24973769 GAGTGAGAACATATGGTATTTGG - Intergenic
1107487711 13:40845720-40845742 GAGTGAGAACAAATGGTATTTGG - Intergenic
1107512019 13:41094554-41094576 GGGACATAACATTTGGTATATGG - Intergenic
1109249122 13:59997153-59997175 GGGTGCAAACATATGGTAGAAGG - Intronic
1109646582 13:65265727-65265749 AGGTGAAAACATATGGTATGTGG - Intergenic
1110544747 13:76744042-76744064 GGGTGAGAACATATGATATTTGG - Intergenic
1110822664 13:79934686-79934708 GGGTGAGAACAGGCGGTATTTGG - Intergenic
1110896092 13:80754345-80754367 GGGTGAAAAGAGATAGTATTTGG + Intergenic
1111442872 13:88303916-88303938 GGGTGATAACTTAGGGTATCTGG + Intergenic
1111599952 13:90460351-90460373 GGGTGGTTGCAGAAGGTATATGG - Intergenic
1116319499 14:43442223-43442245 GAGTGATAACATATGGTATTTGG + Intergenic
1118114400 14:62758837-62758859 GGAGGATAACAGAGGGTGTAGGG + Intronic
1119271529 14:73309479-73309501 GAGTGAGAACAGGTGGTATTTGG - Intronic
1124064578 15:26329515-26329537 GGGTATTTACATATGGTATAAGG - Intergenic
1125058058 15:35386080-35386102 GGGTGAGAACATATGGTGTTTGG + Intronic
1126508676 15:49439745-49439767 GGGTATTAACACATGGTATAAGG - Intronic
1132818309 16:1846708-1846730 GAGTGAGAACATATGGTATTTGG - Intronic
1135862076 16:26065380-26065402 GAGTGAGAACATATGGTATTTGG - Intronic
1140159732 16:72476079-72476101 TGGTGATAACAGAATATATAGGG + Intergenic
1141208491 16:81954568-81954590 GAGTGAGAACATATGGTATTTGG + Intronic
1141481165 16:84307927-84307949 GGGTGATAAAAGGTGATAAAAGG + Intronic
1141873497 16:86805919-86805941 GGGTGTTGACTGATGGGATATGG - Intergenic
1145398587 17:22514316-22514338 GGGAGAGAAGAGAAGGTATAGGG - Intergenic
1149642650 17:58213947-58213969 GGGAGAGAACAGAGGCTATAGGG + Intronic
1150954970 17:69847865-69847887 GAGTGATAACAAATGATATTTGG - Intergenic
1152243722 17:79174149-79174171 GGGTGAAAACACCTGGTAGAAGG + Intronic
1153236653 18:2994846-2994868 TGGTTTAAACAGATGGTATATGG + Intronic
1157508257 18:48247548-48247570 GGTTGTTACCAGATGGTATGGGG - Intronic
1157560468 18:48641884-48641906 AGGGGATAACAGATGGTAGGTGG + Intronic
1159428865 18:68325131-68325153 GGGAGAAAACAGATGGGCTAGGG + Intergenic
1159524503 18:69569948-69569970 AAGTGAGAACAGGTGGTATATGG - Intronic
1160099076 18:75903683-75903705 AGATCATAACACATGGTATACGG - Intergenic
926557465 2:14376167-14376189 GGGTGAGAACAAAGGGTAGATGG - Intergenic
926782999 2:16492672-16492694 GGGTGAGAACATGTGGTATTTGG - Intergenic
929380302 2:41342413-41342435 GAGTGAGAACATATGGTATTTGG - Intergenic
930551957 2:52847106-52847128 GAGTGAGAACATATGGTATTTGG + Intergenic
930581143 2:53213739-53213761 GAGTGAGAACACATGGTGTATGG + Intergenic
931355135 2:61530582-61530604 TGCTGATAACAGAGGGTAGAGGG + Intronic
931416964 2:62090693-62090715 GGGACATAACATCTGGTATACGG - Intronic
932461294 2:71883547-71883569 AGGTGAAAACAGAGGGCATAAGG + Intergenic
932782626 2:74570996-74571018 TAGTGATAACAGATGCTATAGGG + Intronic
936174014 2:110203179-110203201 GAGTGAGAACATATGGTATTTGG - Intronic
940615497 2:156044115-156044137 GAGTGAGAACACATGGTGTATGG + Intergenic
942669398 2:178357992-178358014 GAGTGAGAACAGGTGGTGTATGG - Intronic
943111819 2:183616242-183616264 GAGTGAGAACAGATGGTGTTTGG + Intergenic
943193573 2:184713482-184713504 GAGTGATAATAGGTTGTATATGG + Intronic
943443713 2:187955852-187955874 GGGTGAAAACATGTGGTATTTGG - Intergenic
944308771 2:198208456-198208478 GAGTGTTTACAGATGGTACATGG + Intronic
945736047 2:213601827-213601849 GGTTGAGGACTGATGGTATATGG - Intronic
946542556 2:220700865-220700887 GAGTGAGAACAAATGGTATTTGG + Intergenic
948568239 2:238899872-238899894 GGGTGGGAGCAGAGGGTATATGG + Intronic
1171274287 20:23842445-23842467 GGATGTTAACAGATGTGATAAGG - Intergenic
1173243327 20:41317250-41317272 GGGTGATGACAGATGGCGGAGGG + Intronic
1173379640 20:42528284-42528306 TGGTGCTATTAGATGGTATATGG - Intronic
1175822362 20:61917260-61917282 TGATGGTAACAGATGGTATTTGG - Intronic
1176197073 20:63842346-63842368 GGGTGATGGCAGATGGTTCATGG + Intergenic
1176739474 21:10587452-10587474 GAGTGAGAACATATGGTATTTGG + Intronic
1177734870 21:25076481-25076503 AGGTGATAACATGTGGTATTTGG - Intergenic
1178025277 21:28459305-28459327 GGGTGAGAGCTGATGGAATAGGG - Intergenic
1180578884 22:16810457-16810479 GGGTGATAGCAGGAGGAATAGGG - Intronic
1183008253 22:34921969-34921991 GAGTGAGAACATATGGTATTTGG - Intergenic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
950248654 3:11445439-11445461 AAGTGATAACATATGGTATTAGG - Intronic
953874217 3:46656453-46656475 GAGTGAGAACATATGGTATTTGG - Intergenic
961040048 3:123671823-123671845 GGGGGAGACCAGATGGGATATGG + Intronic
963833787 3:150035920-150035942 TGGTGATATCAGATGAAATATGG + Intronic
964805384 3:160604000-160604022 GGGTGAGAACACATGGTGTTTGG + Intergenic
965023136 3:163261165-163261187 AAGTGATAACAGATGGTAGAAGG - Intergenic
970269879 4:14334762-14334784 AAGTGATAACAGGTGGTATTTGG - Intergenic
972203586 4:36745398-36745420 GAGTGAGAACATATGGTATTTGG - Intergenic
972957221 4:44407745-44407767 GGGTGATGACAGATTATTTAAGG - Intronic
973056359 4:45664148-45664170 TGGTGATAACACCTGGCATATGG + Intergenic
973733901 4:53851167-53851189 GGGTGAAAACAGATGGGACTGGG - Intronic
975943374 4:79675202-79675224 GGGTGAGAACATGTGGTATTTGG - Intergenic
978271575 4:106896457-106896479 GAGTGAGAACATATGGTATTTGG - Intergenic
980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG + Intergenic
981412208 4:144445653-144445675 GAGTGATAACACATGGCATTTGG - Intergenic
981686878 4:147464710-147464732 GGCTGATATCTGATGGCATATGG - Intergenic
982332231 4:154193334-154193356 GGGTGATACCAGGTGGTACTGGG - Intergenic
983439801 4:167766914-167766936 GAGTGATCACAGATGTTATATGG + Intergenic
983972921 4:173896284-173896306 GAGTGATTACAGATGCTATTAGG - Intergenic
984691310 4:182729125-182729147 GGGTGCTATCAGATCCTATAAGG - Exonic
986778054 5:11037455-11037477 TGGTGATATCAGCTGATATAGGG - Intronic
987924987 5:24329477-24329499 GGGTGATAATAGCTGGAGTAGGG - Intergenic
990233173 5:53737362-53737384 GGGTGAGAACACATGGTGTTTGG - Intergenic
991036883 5:62136176-62136198 GGGTGTTGACAGGTGGTTTATGG - Intergenic
993212759 5:84975628-84975650 GAGTGAGAACAGGTGGTATTTGG + Intergenic
993403220 5:87478445-87478467 GAGTGAGAACATATGGTATTTGG - Intergenic
993408895 5:87549420-87549442 GAGTGAGAACATATGGTTTATGG + Intergenic
993923532 5:93837196-93837218 AGGTGAGAACATATGGTATTTGG + Intronic
994619001 5:102140513-102140535 GAGTGAGAACATATGGTATTTGG + Intergenic
996198085 5:120634665-120634687 GAAAGATAACAGATAGTATAAGG + Intronic
997759373 5:136430277-136430299 GGGTGATGACAGATTCTATTTGG + Intergenic
999474156 5:151882756-151882778 GTGTGTTTACAGATGATATAGGG - Intronic
999603104 5:153288831-153288853 GAGTGATAACATGTGGTATTTGG - Intergenic
1000416192 5:160986197-160986219 GAGTGATAACATGTGGTATCTGG + Intergenic
1000485209 5:161833044-161833066 AAGTGATAACATTTGGTATAAGG - Intergenic
1003338882 6:5200858-5200880 GGCTGATAACCACTGGTATAAGG + Intronic
1006270140 6:32958122-32958144 GGGTGGTAACAGAAGGCATGTGG - Intronic
1009417351 6:63430302-63430324 GGGTGAGAACAGCTGGTCTCTGG + Intergenic
1010613332 6:77983587-77983609 GGGTAAAAACAGATGGGAAAGGG - Intergenic
1014718062 6:124888488-124888510 AGGTGACATCAGAGGGTATATGG - Intergenic
1018075523 6:160208960-160208982 GGGTGAGAACATGTGGTATTTGG + Intronic
1022893528 7:34725645-34725667 TGGTGAAAACAGCTGGTATGGGG - Intronic
1023069435 7:36414350-36414372 GGGTGATAATTGATGGGATGAGG + Intronic
1023568631 7:41549814-41549836 GAGTGAGAACAGATGGTGTTTGG + Intergenic
1024572214 7:50732686-50732708 GGGTGTTAATAGATGGTATAGGG - Intronic
1027497036 7:78900640-78900662 GAGTGACAACAGTTGGCATAGGG - Intronic
1027556642 7:79671584-79671606 GTGTGATATATGATGGTATAGGG + Intergenic
1028365912 7:90031741-90031763 GTGTGGTAACAGATTGCATAAGG - Intergenic
1029943452 7:104506207-104506229 GGGTGAAAACTGATTTTATAAGG + Intronic
1031506015 7:122584416-122584438 AGGACATAACAGATGCTATAAGG - Intronic
1032586969 7:133155930-133155952 GAGTGAGAACATGTGGTATATGG - Intergenic
1033117752 7:138640671-138640693 AGGTGAGAACATATGGTATTTGG - Intronic
1033594494 7:142847383-142847405 GGCTGATAACTGATGTTTTAAGG + Intergenic
1036715715 8:11121943-11121965 GAGTGAGAACATGTGGTATATGG - Intronic
1038679054 8:29649963-29649985 TGGAGCTAACAGATGGTAAATGG - Intergenic
1041962745 8:63637458-63637480 GGATGATGACAGATGTTATTAGG + Intergenic
1048778119 8:137970105-137970127 GAGTAAAAACAGATGGTAGAGGG + Intergenic
1052703654 9:31968113-31968135 AGGTGAGAACATATGGTATTTGG - Intergenic
1053567476 9:39268572-39268594 GGGTGACAACTGATGCTATGGGG + Intronic
1054129667 9:61350426-61350448 GGGTGACAACTGATGCTATGGGG - Intergenic
1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG + Intergenic
1058204088 9:102080960-102080982 GAATGAGAACAAATGGTATAGGG - Intergenic
1059618578 9:115977952-115977974 GGGTGATAGCATATGAGATATGG - Intergenic
1059631037 9:116122791-116122813 AAGTGATAACACATGGTATTTGG - Intergenic
1186482620 X:9907531-9907553 GGGTGGTGTCAGATGGTAAAGGG + Intronic
1187978674 X:24731312-24731334 GGGGAATGACAGATGGGATAGGG + Intronic
1188015543 X:25104119-25104141 GACTGCTAACAGATGGTATTTGG - Intergenic
1188851071 X:35132752-35132774 AGGTGAGAACATGTGGTATATGG + Intergenic
1193704393 X:84803429-84803451 AGGTGAGAACACATGGTATTTGG + Intergenic
1194126656 X:90026658-90026680 AAGTGAGAACAGATGGTATTTGG - Intergenic
1194347086 X:92779240-92779262 AGGTGAGAACACATGGTATTTGG - Intergenic
1194811957 X:98398324-98398346 GGGTACTAACTGATGGTAAAGGG - Intergenic
1197837384 X:130709998-130710020 GAGTGAGAACATATGGTATTTGG + Intronic
1199561390 X:149167097-149167119 AAGTGATAACATATGGTATTTGG - Intergenic
1200655412 Y:5895878-5895900 AGGTGAGAACACATGGTATTTGG - Intergenic