ID: 1090817265

View in Genome Browser
Species Human (GRCh38)
Location 11:130309638-130309660
Sequence GGCCTCCTGAAGTGTAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090817265_1090817269 -1 Left 1090817265 11:130309638-130309660 CCAGGATTACACTTCAGGAGGCC 0: 1
1: 0
2: 2
3: 8
4: 86
Right 1090817269 11:130309660-130309682 CGAGGCAGGTGAATCACTTGAGG 0: 129
1: 3520
2: 21266
3: 56053
4: 90466
1090817265_1090817270 4 Left 1090817265 11:130309638-130309660 CCAGGATTACACTTCAGGAGGCC 0: 1
1: 0
2: 2
3: 8
4: 86
Right 1090817270 11:130309665-130309687 CAGGTGAATCACTTGAGGTCAGG 0: 343
1: 8483
2: 38107
3: 83709
4: 171125
1090817265_1090817271 22 Left 1090817265 11:130309638-130309660 CCAGGATTACACTTCAGGAGGCC 0: 1
1: 0
2: 2
3: 8
4: 86
Right 1090817271 11:130309683-130309705 TCAGGAGCTCGAGACCAGCCTGG 0: 1273
1: 57219
2: 216848
3: 226405
4: 143814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090817265 Original CRISPR GGCCTCCTGAAGTGTAATCC TGG (reversed) Intronic
903490178 1:23722416-23722438 AGCCTCCTAAAGTGTATTACAGG - Intergenic
904874272 1:33642090-33642112 GGCCTCCCAAAGTGTGATACAGG - Intronic
905521094 1:38600936-38600958 GGCCTCCTGAAGTGTCAACCAGG - Intergenic
910037584 1:82806314-82806336 GTCCTACTGAAGTGAAAACCAGG + Intergenic
911089745 1:94009091-94009113 GGCCTCCTCATGTGTGATCTTGG + Intronic
918225107 1:182474169-182474191 GGCCTTCTGAATTGTCATCTTGG - Exonic
1063008277 10:1995860-1995882 GTCATCCTGAATTGTAATCCAGG + Intergenic
1069386005 10:67884306-67884328 GTCTTCCTGAAGTGTACACCTGG - Intergenic
1090763207 11:129855050-129855072 GGACTCCTGCAGTGTTAGCCGGG - Intronic
1090817265 11:130309638-130309660 GGCCTCCTGAAGTGTAATCCTGG - Intronic
1094189196 12:27679888-27679910 GGCCTCCTCAGGTCTAATACTGG + Intronic
1097921895 12:65084724-65084746 GGCATCCAGAAGTGTAAACCCGG + Intronic
1103055582 12:117817713-117817735 AGCCTCCTGAGGTATAATTCAGG - Intronic
1103362938 12:120364352-120364374 GGCCTCTGGAAGTGAAATACAGG - Intronic
1103944281 12:124517626-124517648 GCCCTCCTGAAGTCAACTCCGGG + Intronic
1107682360 13:42865062-42865084 GGTCTCCTGATGTTGAATCCAGG + Intergenic
1108357583 13:49641626-49641648 GGCCTCCTAGAGTGTAAAACAGG + Intergenic
1113201470 13:107870837-107870859 GACCCCCTGAACAGTAATCCTGG - Intergenic
1113428708 13:110230866-110230888 GGGCTCCTGATGTGTGGTCCAGG + Intronic
1116685610 14:48035433-48035455 AGCCTCCTGGAGTGACATCCAGG - Intergenic
1119021930 14:71123680-71123702 TCCCTCCTGAAGTGGAATCTGGG + Intergenic
1120385264 14:83837898-83837920 GGCCTCCTGAAGTTCAACCATGG + Intergenic
1121491339 14:94363514-94363536 GGCCTCCTGAACTGTGTTCATGG - Intergenic
1121777910 14:96602950-96602972 GGCCTCCTGACATGCAGTCCAGG + Intergenic
1128746213 15:70116293-70116315 AGCGTCATGAAGTGTAATCACGG + Intergenic
1129542928 15:76365740-76365762 GGCCTCCTGATATATTATCCAGG - Intronic
1131956720 15:97743696-97743718 GTCCTCCTGAAGTGGCATCAAGG - Intergenic
1132744250 16:1430174-1430196 GGCCTCCTGACCTGTGTTCCAGG + Intergenic
1134818851 16:17229251-17229273 GGCCTCCTGAACTGTAGCCCGGG + Intronic
1140406558 16:74715090-74715112 GGCCTCCTCAAGTGTGTTACCGG + Intronic
1140585897 16:76291284-76291306 GTCATCCTGAAGTTGAATCCTGG + Intronic
1140770754 16:78201953-78201975 GGCCTCCCAAAGTGTAATCCTGG + Intronic
1140890101 16:79277870-79277892 TGCCTCCTAAAGTGTGATCTGGG + Intergenic
1144404608 17:14940706-14940728 GGGCCCCTGAAGTGAGATCCAGG - Intergenic
1147789823 17:43006802-43006824 AGCCTCCTGAGGTGTATTTCGGG + Exonic
1148916310 17:50982153-50982175 GTCCTCCCCACGTGTAATCCAGG - Intronic
1155670239 18:28361972-28361994 GGCCTCCTCCAGTGAGATCCAGG + Intergenic
1156929331 18:42622318-42622340 GGAATCCTGAATTTTAATCCTGG - Intergenic
1156957125 18:42980654-42980676 GGCCTCCTGCAGAGGAGTCCAGG - Intronic
926006181 2:9375014-9375036 GGCCTCCTGAAGTAAAGTACTGG - Intronic
930699113 2:54441348-54441370 GGCATCCTGAATTGCAACCCTGG - Intergenic
930868828 2:56149617-56149639 GGCCGCCTGAATTGGAATACAGG - Intergenic
932589416 2:73055217-73055239 GGCCTTCTGCCGTGTAATCTCGG + Intronic
932689469 2:73900140-73900162 GGCCGGCTGAAGTTTTATCCAGG - Intronic
933654662 2:84877831-84877853 GGTCTGCTGAAGAGTAATCTTGG - Intronic
936080153 2:109427573-109427595 GGACTCCCGAAGTGTGAACCTGG - Intronic
941607015 2:167610665-167610687 TGCCTCCTTAAGTTTAATCCTGG + Intergenic
948650719 2:239441854-239441876 GCCCTCCCAGAGTGTAATCCTGG - Intergenic
1169810198 20:9602036-9602058 GGCCTCCCAAAGTGCATTCCTGG - Intronic
1171279672 20:23885086-23885108 GGGCTCCTGAAATGTGATCATGG - Intergenic
1173954701 20:47022124-47022146 TGCCTCCTGAATTCTATTCCTGG - Intronic
1175205074 20:57305114-57305136 GGCCTCCTGACATCTAACCCTGG - Intergenic
1175968284 20:62670899-62670921 TGCCTCCTGGAGTGTCAGCCTGG - Intronic
1179486477 21:41713877-41713899 GGCCTCCTGAGGTGGGAACCGGG + Intergenic
1180248953 21:46566794-46566816 GGCCTCCTGCATTGTCACCCTGG + Intronic
1181401849 22:22654344-22654366 GGCCTGCTACAGTGTCATCCTGG + Intergenic
1181647703 22:24242761-24242783 GGCCTGCTGCAGCGTCATCCTGG - Intronic
1181703803 22:24635438-24635460 GGCCTGCTACAGTGTCATCCTGG + Intergenic
1184714311 22:46272243-46272265 GGCCTCCCAAAGTGTAAACCTGG + Intronic
950885879 3:16362479-16362501 GGACTCCTGGAGTGTTACCCAGG - Intronic
953018240 3:39098192-39098214 GGCCTCATGAAATGTCATCATGG + Exonic
955859004 3:63306800-63306822 GCCTTCCTGAAGTCTAAGCCAGG - Intronic
959177712 3:102937082-102937104 GGCTTCCTGAAATGTAATGTAGG - Intergenic
960892079 3:122459658-122459680 TGCCTCCTGGATTGTAATTCTGG - Intronic
961491246 3:127258016-127258038 GGCCTCCTAAAGGGAATTCCAGG - Intergenic
963224060 3:142842959-142842981 TGACTCCTGCAGGGTAATCCCGG + Exonic
963676159 3:148314807-148314829 GGCCACAAGAACTGTAATCCTGG + Intergenic
964633416 3:158836478-158836500 GGCCTTCTGATGAGTGATCCAGG + Intergenic
965485806 3:169277061-169277083 AGCCTCATGGAGTGAAATCCTGG - Intronic
970171350 4:13293961-13293983 GACCTCCTGAACTCCAATCCTGG + Intergenic
972235564 4:37129743-37129765 GGCCTCCTAATGTGTAAGCTTGG - Intergenic
972732656 4:41810080-41810102 GGTCTCCTGGTGTCTAATCCAGG - Intergenic
972786089 4:42327832-42327854 GGCCTCCTGAAATGCAGCCCAGG - Intergenic
981820805 4:148885436-148885458 GGCCTCCGAAAGCCTAATCCAGG + Intergenic
992349587 5:75915477-75915499 GTCTCCCTGAAGTATAATCCAGG - Intergenic
996021312 5:118593664-118593686 GGCCTCCTGAGGTCTAACTCTGG - Intergenic
998116723 5:139543460-139543482 CGCCTACTGACGTGCAATCCAGG - Intronic
1001196144 5:169675239-169675261 GGCCTCCTGGAGTGGAGTCCAGG + Intronic
1004427765 6:15517699-15517721 GGCCCCATGATGTGAAATCCCGG + Intronic
1004519568 6:16348889-16348911 GGCCACCTGATTTGGAATCCTGG + Intronic
1007590635 6:43018698-43018720 GACCTCTGGAAGTTTAATCCTGG + Exonic
1022472583 7:30690918-30690940 GGCCTCCTGAGCTGTCAGCCAGG + Intronic
1022837277 7:34130311-34130333 ATCCTCCTGAAGTGTATTGCAGG - Intronic
1023052320 7:36263710-36263732 GGTCTCATGAATTGTAATCATGG - Intronic
1030049767 7:105527659-105527681 GGCCTCCCAAAGTGGAATCACGG - Intergenic
1030628943 7:111874114-111874136 GGCCTCCTGAAGTGAGATGCAGG - Intronic
1032552795 7:132801396-132801418 GGACTTCTGAAGTGTAATTGTGG - Intronic
1034187132 7:149186973-149186995 GGCCTCCTGACTTGTTTTCCAGG - Intergenic
1040331911 8:46389993-46390015 GGCCTCCACAAGTGTAAACGTGG + Intergenic
1040336189 8:46417245-46417267 GGCCTCCACAAGTGTAAACGGGG + Intergenic
1042491356 8:69402233-69402255 GGGCTCCTGAAGTGAAGTGCTGG - Intergenic
1048244708 8:132781103-132781125 AGCCTCCCAAAGTGTACTCCTGG + Intronic
1049262384 8:141646558-141646580 GGCCTCCTGAAGTTCACTCTCGG + Intergenic
1049324645 8:142015641-142015663 GGCCGCCTGCTGTGTAACCCTGG + Intergenic
1049347159 8:142145192-142145214 CGCCAACTGGAGTGTAATCCAGG - Intergenic
1057003712 9:91536634-91536656 GGCCTCCTGAAGAGTCATGCTGG - Intergenic
1060409259 9:123389321-123389343 TGCCTCCTGTTGTGTAACCCTGG - Intronic