ID: 1090821558

View in Genome Browser
Species Human (GRCh38)
Location 11:130347039-130347061
Sequence CCACCTAGTTGAAGGCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090821554_1090821558 0 Left 1090821554 11:130347016-130347038 CCGATAATGTGGGTGGGCCTTAT No data
Right 1090821558 11:130347039-130347061 CCACCTAGTTGAAGGCCTGAAGG No data
1090821553_1090821558 1 Left 1090821553 11:130347015-130347037 CCCGATAATGTGGGTGGGCCTTA No data
Right 1090821558 11:130347039-130347061 CCACCTAGTTGAAGGCCTGAAGG No data
1090821551_1090821558 3 Left 1090821551 11:130347013-130347035 CCCCCGATAATGTGGGTGGGCCT No data
Right 1090821558 11:130347039-130347061 CCACCTAGTTGAAGGCCTGAAGG No data
1090821552_1090821558 2 Left 1090821552 11:130347014-130347036 CCCCGATAATGTGGGTGGGCCTT No data
Right 1090821558 11:130347039-130347061 CCACCTAGTTGAAGGCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090821558 Original CRISPR CCACCTAGTTGAAGGCCTGA AGG Intergenic