ID: 1090826545

View in Genome Browser
Species Human (GRCh38)
Location 11:130391192-130391214
Sequence GTGCTAGGTAACCACTGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090826540_1090826545 24 Left 1090826540 11:130391145-130391167 CCAAGAGCATGTATTAGTCGGAA No data
Right 1090826545 11:130391192-130391214 GTGCTAGGTAACCACTGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090826545 Original CRISPR GTGCTAGGTAACCACTGTCC CGG Intergenic
No off target data available for this crispr