ID: 1090828958

View in Genome Browser
Species Human (GRCh38)
Location 11:130407687-130407709
Sequence CTTACTCTGCAGGAAGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090828951_1090828958 2 Left 1090828951 11:130407662-130407684 CCCATATAAAACACCCGAACTTG 0: 1
1: 0
2: 0
3: 15
4: 259
Right 1090828958 11:130407687-130407709 CTTACTCTGCAGGAAGTACATGG 0: 1
1: 0
2: 1
3: 9
4: 186
1090828952_1090828958 1 Left 1090828952 11:130407663-130407685 CCATATAAAACACCCGAACTTGC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1090828958 11:130407687-130407709 CTTACTCTGCAGGAAGTACATGG 0: 1
1: 0
2: 1
3: 9
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090828958 Original CRISPR CTTACTCTGCAGGAAGTACA TGG Intronic
900751204 1:4398949-4398971 CTTTCCCTGCAGAAAGAACATGG + Intergenic
901616521 1:10544386-10544408 CTTCCTCTCCAGAAAGTACGTGG - Intronic
906855055 1:49295180-49295202 CTTACACTGTAGTATGTACAAGG - Intronic
907978249 1:59454694-59454716 AATACTCTGAAGGAAGTAGAGGG - Intronic
908345351 1:63226876-63226898 CTTACTATGTACAAAGTACAAGG + Intergenic
909335990 1:74474634-74474656 CTTACTATTCAGGAAGAAAAAGG + Intronic
910228447 1:84961615-84961637 CTTACTCTGCAGGGAGTGTTTGG - Intronic
912459331 1:109820509-109820531 CTTACTTTGCTGGAAGGTCAGGG + Intergenic
912672970 1:111648575-111648597 CTCCATCTGCAGGAAGTAGAGGG + Intronic
914784523 1:150816498-150816520 CTTAACCTGCAGGAAGTCAAGGG - Intronic
916667496 1:166979671-166979693 TTAAATCTGCTGGAAGTACATGG - Intronic
916776042 1:167965497-167965519 CTCCCTCTGCTGGATGTACAAGG + Intronic
916892554 1:169126211-169126233 CTTACTTTGCAGTAATTAAAAGG + Intronic
917798349 1:178548264-178548286 GTTCCTCTGCAGGATGTAAAAGG + Intronic
918267918 1:182864122-182864144 CTTACTCTGTTGGGATTACAGGG + Intronic
922554283 1:226521155-226521177 TCAACTCTGCAGGAAGTTCATGG - Intergenic
922761576 1:228135355-228135377 CATACTCTGGAGGAAGGACGTGG - Intergenic
924863215 1:247949027-247949049 CTGACTCAGTAGGAAATACATGG - Exonic
924869170 1:248022117-248022139 CTGACTAAGCAGGAAATACATGG - Exonic
924904825 1:248441352-248441374 CTGGCTGAGCAGGAAGTACATGG - Exonic
924920771 1:248626943-248626965 CTGACTGAGCAGAAAGTACATGG + Exonic
924923062 1:248650690-248650712 CTGGCTGAGCAGGAAGTACATGG + Exonic
1064508565 10:16063770-16063792 CTTCTCCTGCAGGAAGCACAAGG + Intergenic
1066353437 10:34659032-34659054 CTTACTCTTCACTAAGAACATGG - Intronic
1067064370 10:43095417-43095439 GTTACTTTGCAGGCAGCACAAGG - Intronic
1069708335 10:70473232-70473254 CCGACTCTGCAGGAAACACAGGG + Intergenic
1070274509 10:74992726-74992748 CTTACTCTGCAAGCAGCACATGG - Intronic
1070601184 10:77867468-77867490 CTCACCCTTCAGGAAGTGCATGG - Intronic
1071479844 10:86056928-86056950 CCAGCTCTGCAGGAAGCACAAGG - Intronic
1078573055 11:12475904-12475926 CTTTCTGTGCAGGAAGAAGATGG + Intronic
1079432607 11:20408464-20408486 CTTAATTTGAAGGAGGTACATGG - Intronic
1085753097 11:79179013-79179035 CTTACTCTGCAGAAATAATATGG - Intronic
1087664896 11:101032734-101032756 CTTATGCTGGAGGAAGTACAGGG - Exonic
1090701321 11:129298529-129298551 CTGAATCTGCAAGAAGTATAGGG - Intergenic
1090828958 11:130407687-130407709 CTTACTCTGCAGGAAGTACATGG + Intronic
1091153603 11:133352630-133352652 CATACGCTGTAGTAAGTACAAGG - Intronic
1095516756 12:43014928-43014950 CTTGTTCTGTAGGCAGTACAGGG - Intergenic
1099364755 12:81754397-81754419 CTTAGGCTGAAGGAAGTAAATGG - Intronic
1099504804 12:83460580-83460602 CTTACTTGGCAGCAAGGACAAGG + Intergenic
1099655501 12:85484407-85484429 CTTACTCTTCAAGTAGTACTTGG - Intergenic
1099953036 12:89325167-89325189 CTTACTCATCAGTAAGCACAAGG + Intergenic
1101296462 12:103428523-103428545 CTTATTCTACAAGAGGTACAAGG + Intronic
1101695045 12:107117243-107117265 CTTTCTCTGCAGGAAGTCTCTGG + Intergenic
1104251722 12:127101010-127101032 CTTTCTCTGGAGGAAGTAGTAGG + Intergenic
1105652697 13:22397398-22397420 CTTACTTTGCAGTAAGTCCTTGG - Intergenic
1105954564 13:25268629-25268651 CTTGATCTGCAGGAAGAAAAGGG - Intronic
1106394695 13:29368318-29368340 CATCCTCTCCAGGAAGTGCAAGG + Intronic
1107240379 13:38226490-38226512 CTTACTTTCCAGGAAACACAAGG + Intergenic
1109761405 13:66834576-66834598 TTTGCTTTGAAGGAAGTACAAGG + Intronic
1109826553 13:67728843-67728865 CTTCCTCTGCAGGTGGGACATGG - Intergenic
1111873830 13:93868052-93868074 CCTACTCTGCAGAAAATCCATGG - Intronic
1112685953 13:101827007-101827029 CTTACTTTGTAGGAAATAAAAGG + Intronic
1113506231 13:110818394-110818416 CTTGTTCTTCAGGAAGGACATGG - Intergenic
1113579930 13:111421474-111421496 CTTACCCTGGAGTAAGTGCATGG + Intergenic
1114135733 14:19847539-19847561 GTTGCTGAGCAGGAAGTACATGG - Intergenic
1119135813 14:72218500-72218522 TTAACTCTGGAGGAAATACAGGG + Intronic
1128330281 15:66751163-66751185 CTTATTCTGCAGGAAGTCAGAGG + Intronic
1129321487 15:74777455-74777477 CCTGCTCTGCAGGAAATAGAAGG + Intergenic
1131151807 15:90051993-90052015 CTTCCTCTGCAGGTGGTAGAAGG - Intronic
1133015644 16:2938248-2938270 CTTCCTCTACAGGAAGGAGAAGG + Exonic
1136387929 16:29941625-29941647 TTTATTCTGCAGCAAGCACAGGG - Intronic
1137772526 16:51028121-51028143 CTAACACAGCAGGAAGCACACGG + Intergenic
1144462692 17:15470415-15470437 CTTACTCAGCTGGAGGTAAAGGG - Intronic
1146984691 17:37204121-37204143 CTTTCTCTGCAAGAAGTCCATGG + Intronic
1149349141 17:55769789-55769811 CTGACTCTGCAGTAATTTCAGGG - Intronic
1149596918 17:57869673-57869695 CTTACCTGGCAGGAAGGACAAGG - Intronic
1153252393 18:3135725-3135747 CTCACACTGCAGCAAGAACAGGG + Exonic
1155487570 18:26362752-26362774 CTTAAAGTACAGGAAGTACAGGG - Intronic
1157498518 18:48172952-48172974 GTTACTCTGCAGTGAGTTCATGG - Intronic
1159159759 18:64628925-64628947 CTAAATCTGCAGGAGTTACATGG - Intergenic
1159408391 18:68036382-68036404 CTCCCTCTGCAGGAAACACATGG + Intergenic
1159567967 18:70076471-70076493 CTTACTCTTCAGGAAGACAAAGG + Intronic
1160188282 18:76693258-76693280 CTTACTCCTCAGGAGATACATGG + Intergenic
1162162786 19:8731201-8731223 CTGGCTGAGCAGGAAGTACATGG - Exonic
1165808712 19:38597374-38597396 CCTATTCTCCAGGAAGAACATGG - Exonic
1167034116 19:46983387-46983409 CTTACTCTGTATGAGGCACACGG - Intronic
1168503384 19:56912489-56912511 CTTAATCTTCAGGAAATAGAGGG - Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925312012 2:2891289-2891311 CTTACTCTGCAGGCCCCACATGG + Intergenic
926120298 2:10238038-10238060 CTTCCTCTATAGGAAGGACACGG + Intergenic
926672246 2:15587422-15587444 CTTACATGGCAGGAGGTACAAGG - Intergenic
927297519 2:21471426-21471448 CTAGTTCTGCAGGAAGTAGATGG + Intergenic
929479949 2:42296184-42296206 CCTACTCTGAAGGAAGTACATGG - Intronic
930792006 2:55342655-55342677 CTTACTCTATAGCCAGTACATGG + Intronic
931062585 2:58547667-58547689 CTTACTCTGCTGGATTCACAGGG + Intergenic
933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG + Intronic
934661285 2:96144962-96144984 CTCACCTCGCAGGAAGTACACGG + Exonic
934869157 2:97844760-97844782 CTTAATCTGCAGAAAGTAACAGG - Intronic
939600544 2:144184173-144184195 TTTACACTGAGGGAAGTACATGG + Intronic
942746435 2:179239371-179239393 AGTCATCTGCAGGAAGTACAAGG + Intronic
946430625 2:219625384-219625406 CTTGGTGTGCAGGATGTACATGG + Intergenic
947647475 2:231754244-231754266 TTTACTCTGCAGTTGGTACATGG - Intronic
948861065 2:240752791-240752813 CCCACTCTGCAGGAAGCCCATGG + Intronic
1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG + Intronic
1169512635 20:6280912-6280934 CTTACAGTGAAGGAAGTAGAAGG - Intergenic
1172261328 20:33568489-33568511 CTTACTCTGCTGGAAGAGCTGGG + Intronic
1172609056 20:36235962-36235984 CTTGGCCTGCAGGAAGGACACGG + Intergenic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1174961196 20:55159116-55159138 CTGACACTGCAGGAAGAAGAGGG + Intergenic
1175301367 20:57945633-57945655 GTTACCCTGCAGGAGGGACAAGG - Intergenic
1176100026 20:63360647-63360669 CCTTTTCTGCAGGAAGGACAAGG - Intronic
1180594378 22:16963725-16963747 CTTGCTCGGCTGGAAGTCCAGGG + Exonic
1180824241 22:18851943-18851965 CTGACTCTGCAGGTGGGACAGGG - Intronic
1181124669 22:20695097-20695119 CTGACTCTGCAGGTGGGACAGGG - Intergenic
1181188495 22:21122605-21122627 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1181210705 22:21287888-21287910 CTGACTCTGCAGGTGGGACAGGG - Intergenic
1181398805 22:22639000-22639022 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1181501536 22:23318356-23318378 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1181650617 22:24257059-24257081 CTGACTCTGCAGGTGGGACAGGG - Intergenic
1181706764 22:24653679-24653701 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1181977956 22:26745336-26745358 CCCACTGAGCAGGAAGTACATGG - Intergenic
1182873811 22:33672935-33672957 GTTACACTGCGGTAAGTACAGGG + Intronic
1183617030 22:38952046-38952068 CTTACTAATGAGGAAGTACACGG - Intergenic
1203216242 22_KI270731v1_random:7542-7564 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1203274378 22_KI270734v1_random:77847-77869 CTGACTCTGCAGGTGGGACAGGG - Intergenic
950349955 3:12340079-12340101 CTTCCCCTTCAGGCAGTACATGG + Intronic
955001041 3:54928303-54928325 TTTAATCTGCTTGAAGTACAGGG + Intronic
957912176 3:86634333-86634355 CTTATTCTCCAGGAAGTGTATGG - Intergenic
959915522 3:111812729-111812751 CTTTCTCTGCAGAAAGTCAAAGG - Intronic
960372520 3:116858741-116858763 CTTAATGTGCGGGAACTACAGGG - Intronic
960789041 3:121406402-121406424 CTTTCTCTGCATGATGTAAAAGG + Intronic
966516639 3:180828255-180828277 CTTCCTCTACAGGAAGGAGAAGG - Intronic
967470179 3:189851905-189851927 CTTACCCTGCAGGGAGTATCTGG + Intronic
969359746 4:6655903-6655925 CTTAGTCTGCAGAAAGTCTAAGG - Intergenic
969878124 4:10150964-10150986 GTTACTCTGCATGAAGAAAAAGG + Intergenic
970714150 4:18900778-18900800 CTTACTTTTCATTAAGTACAAGG + Intergenic
973075982 4:45926325-45926347 TTAACTGGGCAGGAAGTACAGGG - Intergenic
973691659 4:53440175-53440197 CTAATACTGCAGGTAGTACAAGG - Intronic
975972503 4:80058440-80058462 GTTACCCTGAAGGGAGTACAAGG - Intronic
976824598 4:89246967-89246989 CTTACCCTAGAGGAAGTACATGG - Exonic
979746376 4:124218596-124218618 TTTACTCTGCAGAAGGTAGAGGG + Intergenic
979808948 4:125011744-125011766 CCCACTCTGCAGGAATAACAGGG + Intergenic
980897852 4:138876787-138876809 CTTAGTTGGCAGGAAGTCCATGG + Intergenic
984024232 4:174523297-174523319 CTTGCTCTCCAGGAACTCCAGGG + Intergenic
984554560 4:181198649-181198671 CTAACTCTGGAGGCAGGACATGG - Intergenic
985198212 4:187455990-187456012 CTTACACTGCAGGATGCAGATGG + Intergenic
985239519 4:187915440-187915462 TGTACTTTGCAGGAAGAACATGG + Intergenic
989326550 5:40203032-40203054 TTTACTGTGCAGGAAATAGAAGG + Intergenic
991246609 5:64514805-64514827 CATACTCTGGAGCAAGGACAAGG + Intronic
1001349047 5:170938357-170938379 CTTAATCTGCAGGATTTCCAAGG - Intronic
1001485613 5:172117548-172117570 CTTGCTGTGCAGGAAGTTGAGGG + Exonic
1002005106 5:176226150-176226172 ATTAGTCTGCAGGAATTAGAAGG + Intergenic
1002221270 5:177684475-177684497 ATTAGTCTGCAGGAATTAGAAGG - Intergenic
1002714473 5:181217846-181217868 GTTCCTCTGCAGGAAGCCCAGGG + Intergenic
1003194567 6:3903319-3903341 CTTCCTGAGCAGGTAGTACAAGG + Intergenic
1003570133 6:7250564-7250586 CATACACTGCAGCAAGCACAGGG - Exonic
1008511562 6:52280685-52280707 TTTCCTCTTCAGGAAGTACTTGG - Intronic
1008722734 6:54376751-54376773 CTTACTCTGCAGGAACTTTATGG + Intronic
1011370057 6:86627326-86627348 GTTTCTTTGCAGGAAATACAGGG + Intergenic
1014731554 6:125037556-125037578 TTTACTCAGCAGCAACTACAGGG - Intronic
1017456068 6:154602658-154602680 CTTCCTATTCAGGAAGTCCAGGG - Intergenic
1021973412 7:25986858-25986880 CTTTCTCTGGAGGAAGTGCCAGG - Intergenic
1022969769 7:35506058-35506080 CTTACTCTGCAGCAGGCACCAGG + Intergenic
1023547369 7:41332160-41332182 CTTACTCTGAATGAACTAGATGG - Intergenic
1023939309 7:44759793-44759815 ATTTCTCTGCAGCAAGTAGAAGG - Intronic
1026734287 7:72939648-72939670 CTTACTGTGCAGTAATTACTGGG - Intronic
1026784620 7:73294554-73294576 CTTACTGTGCAGTAATTACTGGG - Intergenic
1027109450 7:75425374-75425396 CTTACTGTGCAGTAATTACTGGG + Intronic
1030056685 7:105589350-105589372 CTTACTCTTCAGGAGTTACTTGG + Intronic
1032090143 7:128907448-128907470 CTTATTCTGGAGGAAGGAGATGG + Exonic
1032303634 7:130712655-130712677 CTGACTCTCCAGCAAGTGCAAGG + Intergenic
1032739008 7:134720297-134720319 TTTCCTCTGCAGGAAATAGAAGG - Intergenic
1033880597 7:145878678-145878700 CTTACTGAGGAGGAAGTTCATGG - Intergenic
1035158897 7:156936547-156936569 CTAACCCGGCAGCAAGTACAAGG + Intergenic
1035361624 7:158317342-158317364 ATTACTTTGCAGGAGCTACAAGG + Intronic
1035466797 7:159084633-159084655 CTCACGCTGCAGAAAGTGCAGGG + Intronic
1037022629 8:13992788-13992810 CACACTCTGCAGGAAGTAGAAGG - Intergenic
1037454133 8:19046951-19046973 CTAACTCTCCAGGTAGTATATGG - Intronic
1038667490 8:29552480-29552502 CTAAATATGCAGGAACTACAAGG - Intergenic
1038777999 8:30548377-30548399 GTGACTCTGCCTGAAGTACAGGG - Intronic
1038973773 8:32668466-32668488 CTTACTGGGGATGAAGTACATGG + Intronic
1040562382 8:48535357-48535379 GTTACTGTGCAGGAACCACAAGG + Intergenic
1040595452 8:48834039-48834061 CTCACACTGCAGTAAGAACACGG + Intergenic
1041017143 8:53602025-53602047 CTTATTCTACAGGGAGTTCATGG - Intergenic
1041128183 8:54666754-54666776 CTTACTCTGCACTAAGTCTAGGG + Intergenic
1041354321 8:56984172-56984194 CATACTCAGCTGCAAGTACATGG - Intronic
1043925875 8:86036518-86036540 CTACCTCTGCATTAAGTACAAGG + Intronic
1045421035 8:102015337-102015359 GTTCCTTTGCAGGAAATACATGG - Intronic
1045646340 8:104303265-104303287 CTTCCTCTGCAAGAATTCCATGG - Intergenic
1046307463 8:112388325-112388347 GTTACTCTACTGGACGTACAGGG + Intronic
1047766452 8:127993905-127993927 CTTTCTCTGAAGGAATCACAGGG + Intergenic
1048069413 8:131005819-131005841 CTTCCTCTGCAGCTAGTCCATGG + Intronic
1048458957 8:134603803-134603825 CTCACTCTGCAGGCAGTAACAGG + Intronic
1048907989 8:139106700-139106722 CTAACTCTGCAGAAATTACAGGG + Intergenic
1049706793 8:144046829-144046851 CACACGCTGCAGGAAGTCCACGG - Exonic
1052259634 9:26498946-26498968 GTTACTGTGCAGGGAGCACAGGG + Intergenic
1055100334 9:72457453-72457475 TTTACTTTGCAAAAAGTACAAGG - Intergenic
1056467433 9:86871454-86871476 CTTACTCAGCAGTAAGTTGAAGG - Intergenic
1058205363 9:102099616-102099638 CTTACTCTGAAGAATGAACATGG - Intergenic
1059003419 9:110375000-110375022 CTTACTCTTTAGAAAGAACAAGG - Intronic
1060000541 9:119954291-119954313 CTTTGTCTGCTGGAAGTTCAGGG - Intergenic
1061203356 9:129149596-129149618 CTTACTCACCAGGAAGTAGAGGG + Intergenic
1187158585 X:16744007-16744029 CTGACTTGGCAGGAAATACAGGG + Intronic
1188039593 X:25356719-25356741 CTTACCCTGCAGTAAGGAGAAGG - Intergenic
1193698834 X:84739919-84739941 CTTCCTCTCCAGGAAGTAGCAGG + Intergenic
1198179345 X:134190360-134190382 CTTAGTTTGCAGGAAATAGAGGG + Intergenic
1198841823 X:140865372-140865394 CTTACTCACCAGGAAGTAGTGGG - Intergenic