ID: 1090830072

View in Genome Browser
Species Human (GRCh38)
Location 11:130415068-130415090
Sequence CTGGGTACACAGAATGTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090830072 Original CRISPR CTGGGTACACAGAATGTCGG GGG (reversed) Intronic
911380342 1:97106408-97106430 CTGAGTAAAGAGAATGTGGGCGG + Intronic
921395477 1:214664775-214664797 ATGGGGACACAGAATGTAGGAGG - Intergenic
922880730 1:228978677-228978699 TTGGGAACACAGATTGTCTGGGG - Intergenic
1067070629 10:43128566-43128588 ATGTGAACACAGAATGTTGGTGG - Exonic
1070655834 10:78270606-78270628 GTGGCTACACAGCATGTCAGAGG + Intergenic
1071520205 10:86326699-86326721 ATGGATGCACATAATGTCGGAGG + Intronic
1078265241 11:9750640-9750662 CTGGGTACTCAGAACCTCTGTGG + Exonic
1080116360 11:28625456-28625478 ATGAGAACACAGAATGTCAGGGG + Intergenic
1081012203 11:37827527-37827549 CTGCCTACACAGAATGAAGGAGG - Intergenic
1085250880 11:75143021-75143043 GTGTGTGCACAGAATGTGGGGGG + Intronic
1088777070 11:113095786-113095808 CTGTGAACCCAGAATGTCTGGGG - Intronic
1089189483 11:116643765-116643787 CTGGCCACACAGAAGGTGGGTGG + Intergenic
1089975125 11:122725485-122725507 CAGGGTACCCTGAATGTCGTGGG - Intronic
1090830072 11:130415068-130415090 CTGGGTACACAGAATGTCGGGGG - Intronic
1094410164 12:30159610-30159632 CTGCCTACACAGAATGTCTTTGG + Intergenic
1094820172 12:34218699-34218721 CCGGGTCCACCAAATGTCGGCGG - Intergenic
1096752634 12:53771758-53771780 CTGGGTAAACAGAAACTCCGTGG - Intergenic
1096808889 12:54157340-54157362 CAGGGTACACAGACTGTGTGGGG - Intergenic
1103072897 12:117959552-117959574 CAGGGTAAACAGACTGTAGGAGG - Intronic
1115091574 14:29583146-29583168 CAGGGTACCAAGAATGTCTGAGG - Intronic
1119106605 14:71931256-71931278 CTTAGTACACAGAAAGGCGGGGG - Intergenic
1123022636 14:105408811-105408833 CTGAGTAGACAGAATGCTGGTGG - Intronic
1124700750 15:31909886-31909908 CTGGGTACCCAGAAGGCAGGGGG + Intergenic
1125417899 15:39472761-39472783 CTGGTTACAAGAAATGTCGGTGG + Intergenic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1130899750 15:88198386-88198408 CTGGGTACTCAGAATGTCAGTGG + Intronic
1132021885 15:98369827-98369849 CTGAGTTCACAGGATGTAGGTGG - Intergenic
1136033171 16:27518240-27518262 CAGGGAACACTGAATGACGGAGG + Intronic
1136071722 16:27791510-27791532 GTGGGTAGACAGGATGTGGGTGG - Intronic
1139269701 16:65670710-65670732 CTGGACACACAGAATGTTTGTGG + Intergenic
1141069012 16:80936497-80936519 CTGGGAACCCAGATTGTCAGAGG - Intergenic
1141820672 16:86443270-86443292 CTGGGGACACAGTGTGTCGGGGG + Intergenic
1143019480 17:3909474-3909496 CTGGGGACACAGCGTGTCTGAGG - Intronic
1143125160 17:4637187-4637209 CTGGCTACAGAGAATGACGTTGG + Exonic
1147623544 17:41884357-41884379 CTGGGTACACTGGATTTTGGGGG + Intronic
1148797028 17:50201887-50201909 CTGGGTCCTCAGAATGGCGTGGG + Intergenic
1152073152 17:78143985-78144007 CTGGGGACACAGTATGGGGGAGG + Intergenic
1153493662 18:5675602-5675624 ATGTGTGCACAGAATCTCGGAGG - Intergenic
1157051937 18:44176365-44176387 CTGGGCACCCAGAGTGTGGGTGG - Intergenic
1161937838 19:7382991-7383013 CTGGGTACACAGTATATAAGAGG + Intronic
1162172832 19:8804831-8804853 CTGGGTGCAGAAAATGTTGGGGG + Intergenic
935897097 2:107749197-107749219 CTGGGTACTAAAAATGTTGGTGG + Intergenic
941753599 2:169161198-169161220 GTGGTCACACAGAATGTCAGAGG - Intronic
942223261 2:173791786-173791808 CTGGGCACAAAGAGTGTCGCAGG + Intergenic
1172115379 20:32570524-32570546 CTGGGTACACAGGGTGACTGTGG - Intronic
1173938713 20:46891748-46891770 CTGGGTGCACAGAATCTCCAGGG - Intergenic
1175797839 20:61783915-61783937 CTGGGGGCACAGGATATCGGAGG - Intronic
1175797894 20:61784165-61784187 CTGGGGGCACAGGATATCGGAGG - Intronic
1175797936 20:61784352-61784374 CTGGGGGCACAGGATATCGGAGG - Intronic
1175797964 20:61784477-61784499 CTGGGGGCACAGGATATCGGAGG - Intronic
1175797993 20:61784602-61784624 CTGGGGGCACAGGATATCGGAGG - Intronic
1175798021 20:61784727-61784749 CTGGGGGCACAGGATATCGGAGG - Intronic
1176997189 21:15569219-15569241 CTAGGTAAATAGAATGTTGGAGG - Intergenic
1180903526 22:19392304-19392326 CTGGGCTCAGAGAATGTCTGTGG - Intronic
949690144 3:6627360-6627382 CTTGTTACACAGAATGGTGGGGG - Intergenic
958639793 3:96791045-96791067 CTGGGCTCACAGAATGTCTGAGG + Intergenic
960054770 3:113269305-113269327 CTTGGTCCACAGAATGCCAGAGG + Intronic
962345954 3:134619195-134619217 CTGGGTCCGCAGGATGTCAGTGG + Exonic
969963650 4:10972397-10972419 CTGGGTAAACAAGATGTCCGAGG - Intergenic
970016039 4:11513748-11513770 CTGGAGACAAAGAATGTCTGGGG + Intergenic
970142289 4:12995824-12995846 CTGAGTACACAGGGTGTAGGAGG - Intergenic
977303332 4:95293686-95293708 CTGGGTACAAAGAAGGGAGGAGG - Intronic
984432468 4:179666094-179666116 CAGAGTACACAAAATGTAGGGGG - Intergenic
985949126 5:3209910-3209932 CTGGGTGCACAGGGTGTCTGGGG + Intergenic
990638513 5:57756664-57756686 CTGGGCCCACAGAAGGTTGGAGG + Intergenic
995951000 5:117713865-117713887 CTGGGTAAAGAAAATGTAGGTGG - Intergenic
997383513 5:133454704-133454726 CTAGGTCAACAGAATGTGGGTGG - Intronic
1005927222 6:30453594-30453616 CTGGGCGCACAGTATGTCTGTGG + Intergenic
1005930744 6:30481999-30482021 CTGGGAGCACAGTATGTCTGTGG + Intergenic
1006461264 6:34160321-34160343 CTGGGGACACACAATGTCAGTGG - Intergenic
1008603643 6:53119577-53119599 CTGGGAAGACAGAATGTGGCAGG - Intergenic
1022041491 7:26586168-26586190 CTGGGATCACAGAATTTCGAGGG - Intergenic
1022274223 7:28839711-28839733 CTGGGTAAAAAGAAGGTCTGAGG - Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1029199042 7:98826592-98826614 CTAGGAACAGAGGATGTCGGTGG + Intergenic
1032200611 7:129820051-129820073 CTGGGTACACAGAAGTGGGGAGG + Intergenic
1046813687 8:118560252-118560274 CTGGGTCCCCAGAATGTCTGTGG - Intronic
1057164634 9:92916087-92916109 CTGGCTACACAGAATGATGTTGG - Intergenic
1060961851 9:127686370-127686392 CTGAATATACAGAATGTCAGAGG - Intronic
1061588643 9:131584164-131584186 CTGGTCACACAGCATGTCGGTGG + Intronic
1185745485 X:2569408-2569430 CTGGGTAGACTGAGAGTCGGTGG - Intergenic
1195422225 X:104688254-104688276 CTGGGTACACCTAATTTTGGGGG - Intronic
1196039116 X:111182459-111182481 CTAAGTACACAGAATGTAGCTGG - Intronic
1202033491 Y:20605058-20605080 TTGGGGACTCAGAATGTAGGAGG + Intergenic