ID: 1090830708

View in Genome Browser
Species Human (GRCh38)
Location 11:130419046-130419068
Sequence CACGGACCTGTCTGGTGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 98}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090830690_1090830708 30 Left 1090830690 11:130418993-130419015 CCTTTGATCTGCCCATCCTGTCT 0: 1
1: 0
2: 1
3: 23
4: 262
Right 1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG 0: 1
1: 0
2: 2
3: 4
4: 98
1090830694_1090830708 14 Left 1090830694 11:130419009-130419031 CCTGTCTCCCTTCCTCCCCAGGG 0: 1
1: 1
2: 11
3: 103
4: 829
Right 1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG 0: 1
1: 0
2: 2
3: 4
4: 98
1090830696_1090830708 7 Left 1090830696 11:130419016-130419038 CCCTTCCTCCCCAGGGCTTCCGG 0: 1
1: 0
2: 0
3: 28
4: 358
Right 1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG 0: 1
1: 0
2: 2
3: 4
4: 98
1090830701_1090830708 -1 Left 1090830701 11:130419024-130419046 CCCCAGGGCTTCCGGAGCCAGGC 0: 1
1: 0
2: 7
3: 22
4: 308
Right 1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG 0: 1
1: 0
2: 2
3: 4
4: 98
1090830692_1090830708 18 Left 1090830692 11:130419005-130419027 CCATCCTGTCTCCCTTCCTCCCC 0: 1
1: 2
2: 124
3: 1823
4: 14425
Right 1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG 0: 1
1: 0
2: 2
3: 4
4: 98
1090830698_1090830708 6 Left 1090830698 11:130419017-130419039 CCTTCCTCCCCAGGGCTTCCGGA 0: 1
1: 0
2: 1
3: 33
4: 318
Right 1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG 0: 1
1: 0
2: 2
3: 4
4: 98
1090830691_1090830708 19 Left 1090830691 11:130419004-130419026 CCCATCCTGTCTCCCTTCCTCCC 0: 1
1: 1
2: 45
3: 640
4: 4944
Right 1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG 0: 1
1: 0
2: 2
3: 4
4: 98
1090830699_1090830708 2 Left 1090830699 11:130419021-130419043 CCTCCCCAGGGCTTCCGGAGCCA 0: 1
1: 0
2: 1
3: 28
4: 240
Right 1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG 0: 1
1: 0
2: 2
3: 4
4: 98
1090830703_1090830708 -3 Left 1090830703 11:130419026-130419048 CCAGGGCTTCCGGAGCCAGGCAC 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG 0: 1
1: 0
2: 2
3: 4
4: 98
1090830702_1090830708 -2 Left 1090830702 11:130419025-130419047 CCCAGGGCTTCCGGAGCCAGGCA 0: 1
1: 1
2: 1
3: 19
4: 299
Right 1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG 0: 1
1: 0
2: 2
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090830708 Original CRISPR CACGGACCTGTCTGGTGAGC AGG Exonic
900353823 1:2250264-2250286 CACGGGACTCTCTGTTGAGCAGG - Intronic
907400207 1:54220599-54220621 CAAGGACCTGTCTGTGGAGGGGG - Intronic
923084747 1:230694844-230694866 CACAGCCCTGCCAGGTGAGCCGG - Intergenic
1073073597 10:100809767-100809789 CACTGACCTCTCTGGGAAGCAGG - Intronic
1074029928 10:109676952-109676974 CAGGGGCATGTCTGGGGAGCTGG + Intergenic
1075595565 10:123726693-123726715 CACCATCCTGTCTGGTGAGGGGG + Intronic
1076677214 10:132153375-132153397 CCCTGACCTGCCTGGTGAGCTGG + Intronic
1076688069 10:132207074-132207096 CACAGGCCTGTCTGGAGCGCTGG + Intergenic
1081666521 11:44920008-44920030 CACTCCCCTGTCTGGAGAGCAGG - Intronic
1083491660 11:63018597-63018619 CATGGACCTGTGTTTTGAGCTGG + Intergenic
1085559570 11:77458655-77458677 TACAGACCTTACTGGTGAGCAGG + Intronic
1087714069 11:101586722-101586744 CACGGACCTGTGGGGTGGGATGG + Intronic
1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG + Exonic
1092938930 12:13389726-13389748 CACGGACCAGGGTGGTGAGATGG - Intergenic
1102212109 12:111134929-111134951 CAGGGACATGTCTGGAGAGTAGG + Intronic
1104685689 12:130782682-130782704 CACTGACCTCGCTGGTGACCTGG - Intergenic
1113743672 13:112727970-112727992 AAGGGCCGTGTCTGGTGAGCAGG + Intronic
1114530143 14:23390353-23390375 CTCAGACCTGTCTCGGGAGCTGG - Exonic
1114535573 14:23420141-23420163 CTCAGACCTGTCTCGGGAGCTGG - Exonic
1114646328 14:24258526-24258548 CATGATTCTGTCTGGTGAGCTGG - Exonic
1116243466 14:42378661-42378683 CAGGGACCTGTGTTGAGAGCAGG - Intergenic
1118349813 14:64965735-64965757 CACCAGCCTGTCTGGGGAGCGGG + Intronic
1121458461 14:94054724-94054746 CACTGCACTGTCTGGTGAGGAGG + Intronic
1122269335 14:100561335-100561357 CATGCACCTGGCTTGTGAGCTGG - Intronic
1122654146 14:103245971-103245993 CATGGGCCCTTCTGGTGAGCTGG + Intergenic
1123800565 15:23815468-23815490 CAAGGAGCTGTGTGGTGAGTGGG + Intergenic
1126144075 15:45461134-45461156 CACGGACCCATCTGGCGAGGAGG + Intergenic
1127938585 15:63669531-63669553 CACGCACCTGTGCGGTTAGCTGG + Exonic
1128063059 15:64747411-64747433 CTGGGACCTGGCTGGGGAGCAGG - Intronic
1130609128 15:85344658-85344680 GAGGGACCTGCCTGGGGAGCAGG + Intergenic
1132633227 16:929824-929846 GACGGACGTGACTGCTGAGCAGG - Intronic
1134895775 16:17885702-17885724 CAAGAACCTGTCTGGTTAACAGG - Intergenic
1137248652 16:46727286-46727308 CACAGATCTGCCTGGTGAACAGG + Exonic
1137659221 16:50189471-50189493 CCCAGACCTGTCTGGAGAGTTGG - Intronic
1138348749 16:56335392-56335414 CAGGGGCCTGACGGGTGAGCTGG + Intronic
1143013271 17:3878084-3878106 CACAGACCTTGCTGATGAGCAGG - Intronic
1143307343 17:5958007-5958029 CCCGGATCTGTCTGGTTTGCAGG + Intronic
1143457636 17:7078180-7078202 CAGGGAGCTGTCTAGTGAGGAGG + Intronic
1148170470 17:45515284-45515306 CACTGAGCTGACTGTTGAGCCGG - Intergenic
1148170947 17:45519277-45519299 CACTGAGCTGACTGTTGAGCCGG - Intergenic
1148365073 17:47049275-47049297 CACTGAGCTGACTGTTGAGCCGG + Intergenic
1150478962 17:65495141-65495163 CACAGACCTGGCAGGTGCGCTGG - Intergenic
1150532843 17:66003656-66003678 CATGGACCTGTATGGTGCCCAGG - Intronic
1151548495 17:74807771-74807793 AACAGACCTGTCTGTGGAGCTGG - Intronic
1152388295 17:79988209-79988231 CACGGCCCTGGCTGGTGGCCAGG - Intronic
1152531708 17:80922838-80922860 CACGGACCTGCAGGCTGAGCGGG - Intronic
1155621173 18:27782115-27782137 CACGATCCTCTCTAGTGAGCTGG + Intergenic
1155656667 18:28201021-28201043 CACAGAGATGGCTGGTGAGCAGG + Intergenic
1156011664 18:32503688-32503710 GATGGATCTGTCTGGTGTGCTGG + Intergenic
1158327373 18:56326098-56326120 CAGTGACATGTCTGGTGAACTGG - Intergenic
1162106258 19:8371509-8371531 CAAGAGCCTCTCTGGTGAGCAGG + Exonic
1163833868 19:19561879-19561901 CACGGGCCTGGCTGAGGAGCAGG + Exonic
1165212573 19:34247560-34247582 CACAGACCTTTCTGCAGAGCTGG + Intergenic
1165938661 19:39404040-39404062 CCCGGGCCGGTCTCGTGAGCTGG - Intergenic
926423878 2:12724053-12724075 CACGGACCTCTATTCTGAGCTGG - Intronic
927547854 2:23970558-23970580 CACGGACCTGTCAGGAGAGAAGG + Intronic
932904745 2:75737960-75737982 CTTGGTCCTGTCTTGTGAGCAGG - Intergenic
938576009 2:132605476-132605498 CCTGGACCTTTCTGGAGAGCAGG - Intronic
947495361 2:230632288-230632310 CTCAGGCCTGTCTGGGGAGCGGG - Intergenic
947751869 2:232537067-232537089 CTCACACCTGTCAGGTGAGCAGG + Intergenic
948292143 2:236833539-236833561 CATGCACCTGTCTGGGGTGCTGG - Intergenic
948550945 2:238772739-238772761 TACGGATCTGCCTGGTGTGCAGG - Intergenic
949007868 2:241660284-241660306 CACACACCTGTGTGGTGACCTGG - Intronic
1170916265 20:20628958-20628980 CACGGAGCTCTCTGAGGAGCTGG - Intronic
1172165068 20:32893918-32893940 CACGCCCCTGCCTGGTGAGTGGG + Intronic
1172896349 20:38302964-38302986 CAGGGACCTGTCTGGAAAGCTGG + Intronic
1174769291 20:53283394-53283416 CAGGGACCTATCTGGTGTGATGG - Intronic
1175346980 20:58286783-58286805 CACAGCCCTGCGTGGTGAGCAGG - Intergenic
1180733457 22:17999367-17999389 CACAGAAATGTCTGGAGAGCTGG + Intronic
1184639860 22:45864783-45864805 CAAGGACCTTCCTGGGGAGCAGG - Intergenic
950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG + Exonic
950621577 3:14210009-14210031 CACGGAGCCTGCTGGTGAGCAGG + Intergenic
985865783 5:2512866-2512888 CAGGGAGATGGCTGGTGAGCAGG + Intergenic
987119895 5:14757137-14757159 CACGGACCTGTCCAGGAAGCTGG + Intronic
987957249 5:24755962-24755984 CTGGGTCCTGTCTGGGGAGCAGG + Intergenic
988560843 5:32279710-32279732 CACGGACCTGGCAGGGGGGCAGG + Intronic
993469498 5:88289310-88289332 CACGGTCCTGGCTGGTTATCAGG - Intergenic
997453975 5:134004478-134004500 CGCGGGCCTGGCTGGTGAGCGGG - Intronic
999804121 5:155066303-155066325 CATGGGTCTTTCTGGTGAGCTGG + Intergenic
1000612305 5:163387772-163387794 GACTGACCTGGCTGGTGACCTGG - Intergenic
1002164703 5:177337127-177337149 CGGCGACCTGTCTGGTGAGTGGG - Exonic
1004333387 6:14741740-14741762 GGCAAACCTGTCTGGTGAGCCGG + Intergenic
1004357755 6:14944845-14944867 CACTCACCTGGCTGGGGAGCAGG + Intergenic
1006509677 6:34515183-34515205 CAGGGACCAGGCTGGGGAGCGGG + Intronic
1008109716 6:47478486-47478508 CCCGCACCTTTCTGGTGAACAGG - Intronic
1008551207 6:52633113-52633135 CACGGACATGTGAGGTGGGCGGG + Intergenic
1014558125 6:122857677-122857699 TACGGCCCTGTCTGGTGTTCTGG - Intergenic
1019724776 7:2595484-2595506 CAGGGACCCGGCAGGTGAGCAGG + Intronic
1027243753 7:76351523-76351545 CACGAACCTGGCTGCAGAGCAGG + Intronic
1034413507 7:150953421-150953443 CCCGGACCTGTGTGGAGAGGGGG - Intronic
1034875271 7:154719918-154719940 CAGGGACCAGACTGGAGAGCAGG + Intronic
1036216208 8:6881966-6881988 CACGGACATCTCAGGAGAGCAGG + Intergenic
1037448911 8:18997215-18997237 CAGGGAGCTGTCTGGTAGGCAGG - Intronic
1039024224 8:33240225-33240247 CACCTTCCTGGCTGGTGAGCAGG + Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1049095047 8:140543832-140543854 CACGGGCCTGTCTGGGGTTCGGG + Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049805705 8:144537879-144537901 CCCGCACTTGGCTGGTGAGCAGG + Intronic
1061299608 9:129697221-129697243 CCGGGACCTGCCTGGAGAGCGGG + Intronic
1062707940 9:137955496-137955518 CAGGGAGCTGTCTGGTGCTCTGG + Intronic
1194838978 X:98715333-98715355 CAGGGGCCTGTCTGGTGAAGGGG + Intergenic
1195002255 X:100653159-100653181 CCCTGACCTGTCTCCTGAGCTGG + Intronic
1198310506 X:135423575-135423597 CAAGGACGTGTCTGGTGGCCAGG + Intergenic
1202380267 Y:24270815-24270837 GAGGGACCTGCCTGGGGAGCAGG + Intergenic
1202490516 Y:25399310-25399332 GAGGGACCTGCCTGGGGAGCAGG - Intergenic