ID: 1090831425

View in Genome Browser
Species Human (GRCh38)
Location 11:130423412-130423434
Sequence TTTCTGTTGTCATCCAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090831417_1090831425 14 Left 1090831417 11:130423375-130423397 CCCTGGTAGCCACAGAGCAGGGG 0: 1
1: 0
2: 0
3: 41
4: 306
Right 1090831425 11:130423412-130423434 TTTCTGTTGTCATCCAAACCAGG 0: 1
1: 0
2: 0
3: 11
4: 168
1090831419_1090831425 13 Left 1090831419 11:130423376-130423398 CCTGGTAGCCACAGAGCAGGGGG 0: 1
1: 0
2: 0
3: 36
4: 313
Right 1090831425 11:130423412-130423434 TTTCTGTTGTCATCCAAACCAGG 0: 1
1: 0
2: 0
3: 11
4: 168
1090831424_1090831425 5 Left 1090831424 11:130423384-130423406 CCACAGAGCAGGGGGGGGCATGA 0: 1
1: 0
2: 7
3: 51
4: 359
Right 1090831425 11:130423412-130423434 TTTCTGTTGTCATCCAAACCAGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090831425 Original CRISPR TTTCTGTTGTCATCCAAACC AGG Intronic
906417692 1:45633938-45633960 TTTCTGTTAGCATCCAAAAGTGG - Intronic
906968294 1:50482394-50482416 TATTTGTAGTCATCTAAACCTGG - Intronic
908343827 1:63210990-63211012 TTTCTATTGTCATTCCACCCAGG - Intergenic
908855404 1:68421239-68421261 TTTTTGTTGTAACCAAAACCTGG + Intergenic
911155906 1:94636639-94636661 TTTCACTTATAATCCAAACCAGG - Intergenic
912046215 1:105461703-105461725 TTTCTGTTGTGAACTAAACATGG - Intergenic
912476506 1:109940563-109940585 TTTCTGAAGTCATCCACAGCAGG + Intergenic
912515582 1:110214797-110214819 TTTCTGATGTCATCCACAGGAGG - Intronic
913997147 1:143660842-143660864 TTCCTGTTGGCATACAAACTTGG + Intergenic
914505109 1:148281940-148281962 TTGCTGTTGGCATACAAACTTGG - Intergenic
914507455 1:148302208-148302230 TTGCTGTTGGCATACAAACTTGG + Intergenic
917099832 1:171433800-171433822 TTTTTGTTTTCATCCAAAAGAGG - Intergenic
919289281 1:195608847-195608869 TTTCTGTGGTCTACCAATCCAGG - Intergenic
920625978 1:207599684-207599706 TTTCTGTTGACATCACAACATGG - Intronic
924341324 1:243036104-243036126 TTTCTAATGACATCCAAATCAGG - Intergenic
1065068646 10:22000013-22000035 TTCCTGATGTTCTCCAAACCAGG + Intronic
1069174193 10:65270204-65270226 TTTCTCTTGTAAACCTAACCTGG - Intergenic
1069746515 10:70718120-70718142 TTTTTGTGGTGTTCCAAACCAGG - Intronic
1069994458 10:72333913-72333935 TTACTGCTGCCATCAAAACCAGG + Exonic
1070426435 10:76292745-76292767 TTTCTGGTGTCAGTCAAAGCAGG - Intronic
1070591901 10:77807489-77807511 TTTCTGGTGTCCCCCAAGCCAGG - Intronic
1070730101 10:78821195-78821217 GCTCTGTGGTCAGCCAAACCAGG + Intergenic
1070896842 10:79990937-79990959 TTTCTCTTATCTTCCAAAACTGG - Intergenic
1071816885 10:89241208-89241230 TTTCTGCTCTGATCCCAACCTGG + Intronic
1074301355 10:112235773-112235795 TATAATTTGTCATCCAAACCAGG - Intergenic
1076561912 10:131372451-131372473 GTTCTGTGGTCACCTAAACCTGG + Intergenic
1084579514 11:70014368-70014390 TTGATGTTGACATCAAAACCAGG - Intergenic
1085454027 11:76655828-76655850 TTCCTGTTTTCAGCCAAACGTGG - Intergenic
1087235819 11:95717491-95717513 TTTCTGTTCTTATCAGAACCTGG - Intergenic
1088065044 11:105707145-105707167 TTTCTATTGTCATCAAAGCCAGG - Intronic
1090110225 11:123899617-123899639 ATTCCGTTTTCATCAAAACCAGG + Intergenic
1090129132 11:124121054-124121076 TTGCTGTTCTCATCCACACAAGG + Intronic
1090394001 11:126407212-126407234 ATTCTGTTCTCATCCCCACCCGG + Intronic
1090831425 11:130423412-130423434 TTTCTGTTGTCATCCAAACCAGG + Intronic
1092890652 12:12966334-12966356 TTCCTGTTGGCATCCTAAGCAGG + Intergenic
1095221981 12:39626474-39626496 TTTTTATTGTTATCCAAATCGGG + Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1099482940 12:83191024-83191046 TTTCTGAAGTCTTCCAAACCTGG - Intergenic
1099896361 12:88652610-88652632 TTTCTGTGGTGATCCTAAACAGG - Intergenic
1103666871 12:122574814-122574836 TTTCTGTGGTTATGCAAACATGG + Intronic
1104870609 12:131992623-131992645 TATCTGTTCTCATCTGAACCAGG - Intronic
1106931334 13:34668936-34668958 ATGCTGTTGTCAGCCAAACACGG + Intergenic
1110077750 13:71270187-71270209 TTTCTGTTGTCATCTTCATCAGG - Intergenic
1111497175 13:89067311-89067333 TTTCTTTTGACAGTCAAACCTGG - Intergenic
1115514329 14:34170270-34170292 TTTATGTTGTCTTCAAAATCTGG - Intronic
1118168535 14:63361790-63361812 TTTCTTTTATAATCTAAACCTGG + Intergenic
1119890322 14:78177581-78177603 TATATTTTATCATCCAAACCGGG - Intergenic
1121142078 14:91552023-91552045 TTTCCGTTGTCATCCTGTCCAGG + Intergenic
1121424598 14:93840601-93840623 TTTCTTTTTTCCCCCAAACCTGG + Intergenic
1121823863 14:96994343-96994365 TTGCTATTGTCAGACAAACCTGG + Intergenic
1124114994 15:26832195-26832217 TTACTGTTCGCATCCAAACCGGG - Intronic
1129087528 15:73111625-73111647 TTTCTTTGGTCATCCAGACTAGG + Intronic
1129943803 15:79521872-79521894 TTTCTGTTGACATCCATAAAAGG - Intergenic
1131825014 15:96313624-96313646 TTTCTCTTGGCCCCCAAACCAGG - Intergenic
1139024152 16:62793243-62793265 CTTTTGCTGTTATCCAAACCTGG + Intergenic
1140133463 16:72184239-72184261 TTTCAGTTATCATCCATATCAGG + Intergenic
1140420684 16:74816621-74816643 TTTCTGTAGGCATCCTATCCGGG - Intergenic
1141756130 16:85992184-85992206 TTTTTGTTGTCATGCTAACTGGG - Intergenic
1143335235 17:6167162-6167184 ATTCTCTTGCCATCCATACCTGG - Intergenic
1145799704 17:27675081-27675103 CTTCTTGTGCCATCCAAACCTGG + Intergenic
1146732674 17:35208309-35208331 ATAATGTTGTCATCCAATCCAGG - Intergenic
1146818411 17:35963593-35963615 TCTCTGTTGGCATCCACATCTGG + Intergenic
1148113798 17:45162728-45162750 TTTCTGTTGTTGTTCAAAGCAGG + Exonic
1148206126 17:45781377-45781399 TTTCTCCTGTCTTCCAAATCTGG + Intergenic
1148677644 17:49454366-49454388 TTTCTCTTGCCATCCAAATTGGG - Intronic
1149624558 17:58071085-58071107 TGTCTGTTTTCCTCCATACCAGG - Intergenic
1150184493 17:63165645-63165667 TTTCTGTTGGTTTCCAAATCTGG - Intronic
1150197767 17:63318953-63318975 TCTCTGTTGGCATCCACATCTGG - Exonic
1151988790 17:77560703-77560725 TTTCTGTTGTTATCCATAATTGG - Intergenic
1153591462 18:6677996-6678018 TATCTGTTGTCATCTATCCCAGG - Intergenic
1153647432 18:7207726-7207748 TTCCTGTTGGCATCAAAATCTGG - Intergenic
1153721558 18:7908681-7908703 CTTCTGTTGTCAGCAAAACTGGG + Intronic
1159579255 18:70216906-70216928 TTTCTTTTGAGATCCAGACCAGG + Intergenic
1159671643 18:71227541-71227563 TTTCTTTTTTTATCCAAATCTGG + Intergenic
1161606447 19:5217497-5217519 CTTCTGTTTTCATCCAAATGAGG - Intronic
926003751 2:9355114-9355136 TTTATGTAGTTATCAAAACCAGG + Intronic
929432202 2:41896764-41896786 TTTTTGTTGACATCTCAACCTGG - Intergenic
931119215 2:59197892-59197914 TTCCTGGTGTCATCCCAGCCAGG + Intergenic
931890692 2:66668137-66668159 TTTCTTTTGTCATTCAAAGTAGG + Intergenic
932103781 2:68924626-68924648 TTGCTAATGTCATCCAAACTTGG - Intergenic
933016550 2:77135357-77135379 CTTCTGTTTTCATCATAACCAGG + Intronic
933038884 2:77435107-77435129 TTTTTGTTGTCATCACAACTTGG - Intronic
934936323 2:98468527-98468549 TTTCTGTTTTCAGCCATACATGG - Intronic
936996275 2:118417379-118417401 TTTCTGCTGACATCCATTCCAGG - Intergenic
939782347 2:146464888-146464910 CTTCTATTCTCATCCAATCCTGG + Intergenic
942977950 2:182041576-182041598 TCTCTGTTGTCATCCTAGACTGG - Intronic
943232865 2:185277893-185277915 TTTCTGTTCTGCTCCAAACAAGG - Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944887700 2:204081588-204081610 CTTATGTAGTCATCCAATCCTGG - Intergenic
946716652 2:222560128-222560150 TTTTTGCTTTCATACAAACCTGG + Exonic
948621107 2:239235276-239235298 TTTCTGTCATTTTCCAAACCCGG - Intronic
1170377152 20:15712603-15712625 TTTATTTTGTCATCCAAGCTTGG + Intronic
1174747311 20:53076238-53076260 TTTCTGCTGTCATCCAGTCCAGG - Intronic
1177261972 21:18741220-18741242 TTTCTTTTGCCATGCAAATCTGG + Intergenic
1177602150 21:23329746-23329768 TGTCAGTTGTCAAACAAACCTGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178276584 21:31243932-31243954 TGTCTTTTATCATCCAAGCCAGG - Intronic
1184368622 22:44068559-44068581 TTTCTGTTGTCGTGGAAACGGGG + Intronic
950373078 3:12547510-12547532 TTTCTCTTGTCACCCAAGCTGGG - Intronic
951273299 3:20654313-20654335 TTTCTGTTGCCATCTAAAAATGG + Intergenic
957400016 3:79699366-79699388 TTTCAGATGTCAGACAAACCTGG - Intronic
957752897 3:84445730-84445752 TTACTGTTCTCATCCACACTTGG + Intergenic
960909205 3:122631986-122632008 TGTCTCTCGTCATCCAAACCTGG - Intronic
961019746 3:123495582-123495604 TTTTTTTTAACATCCAAACCTGG - Intronic
961976694 3:131032621-131032643 TTTTTGTTCACATCCAAAGCTGG - Intronic
962378827 3:134880509-134880531 TGCCTGTTGTCATCCTAACAAGG + Intronic
964123261 3:153208681-153208703 TTCCATTTGTCATCCAAACCAGG + Intergenic
964157748 3:153606198-153606220 TTTCTATTGTCATTCACATCAGG - Intergenic
964369145 3:155981522-155981544 TTTCTGTTATAAACCAAACTTGG + Intergenic
968037281 3:195558483-195558505 TTTCTGTTATAATTCAAAACAGG + Intergenic
970667149 4:18350398-18350420 TTTCTGTTCTTATCCTTACCTGG + Intergenic
974528159 4:63072618-63072640 ATTCTTTAGTCATACAAACCAGG + Intergenic
975199287 4:71566332-71566354 CTTCTGTTGGCATCATAACCTGG + Intronic
975938677 4:79613705-79613727 TTTCTGTTGCCATCAACAACCGG - Intergenic
978351938 4:107828464-107828486 TTTCTCTCCTCATCCAAACATGG + Intronic
980115647 4:128676774-128676796 TTTCTCTTGTCCTCAAAAACTGG + Intergenic
980968732 4:139549464-139549486 TTTTTGTTGTCATCTCAACTGGG - Intronic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982424306 4:155239363-155239385 TTTCTGTTGTCATTCAATTTTGG + Intergenic
982533390 4:156576806-156576828 TTTCTGTTGTCATTCAATTTTGG - Intergenic
984349517 4:178571949-178571971 TCTCTGTTGTCATCCACTCCTGG - Intergenic
984515319 4:180731663-180731685 TTTGTGTTCTCAGCAAAACCGGG - Intergenic
987334254 5:16885035-16885057 TTTCTGGTATCATTAAAACCGGG + Intronic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
995168338 5:109075274-109075296 TTTCTGTTGTTATCTAAGCATGG + Intronic
995527058 5:113058638-113058660 TCTCTGATGTCAGTCAAACCTGG + Intronic
996764679 5:127023920-127023942 TTCCTTTTGTCATCCAATGCAGG - Intronic
996778204 5:127156010-127156032 TTTTTGTTGTTATCTATACCAGG + Intergenic
997351124 5:133232252-133232274 TTTCTTTAGTCAACCAAATCAGG + Intronic
999524630 5:152391165-152391187 TTTCTTTTGTATTCCAAACTTGG + Intergenic
1003096998 6:3150019-3150041 CTTCTGACGCCATCCAAACCTGG - Intronic
1003162179 6:3645712-3645734 TTTCTGTTGTCTGGCAAACATGG - Intergenic
1003980077 6:11381144-11381166 TTTCTGTTTTCTTCCAAGCTTGG - Intronic
1004694156 6:18018590-18018612 TCTCTGTTTCCATCTAAACCAGG - Intergenic
1005768159 6:29036029-29036051 TGTCTGTTGTCATCAGGACCAGG + Intergenic
1008189196 6:48433395-48433417 TTCATTTTGTCATACAAACCAGG - Intergenic
1008766428 6:54922011-54922033 TATCTGATGTCAACCAAGCCAGG - Intronic
1010044890 6:71430046-71430068 TTTCTGTTGTTTTCCTACCCCGG - Intergenic
1011432199 6:87299656-87299678 TTTCTGTTGTCACCAAAATCTGG - Intronic
1011853235 6:91656404-91656426 TTTCTGTAATCAAACAAACCTGG + Intergenic
1013458557 6:110355170-110355192 TTTCTGTTGTCATTCCAAGTGGG + Intronic
1016121662 6:140350139-140350161 TTTATTTTGACATCAAAACCTGG + Intergenic
1019342551 7:515475-515497 GTTCTGTTTTCAGCCACACCTGG + Intronic
1020152425 7:5693335-5693357 TTTCTGTAAACATCCATACCAGG - Intronic
1021829151 7:24585929-24585951 TCTCTTTTATCATCCAAACTTGG + Intronic
1022817308 7:33926135-33926157 TTTCTGTTCCCATCAAAACCTGG + Intronic
1026557018 7:71417397-71417419 TTTTTGCTGTCATCAAACCCTGG + Intronic
1026971823 7:74473191-74473213 TTCTGGTTGTCATCCCAACCAGG - Intronic
1030055226 7:105578209-105578231 TATGAGTTATCATCCAAACCGGG - Intronic
1030917658 7:115336966-115336988 TGTCTTTTGTCATCTACACCAGG - Intergenic
1032950662 7:136907253-136907275 TTTTTGTAGTCATCTAAAGCAGG - Intronic
1035619961 8:1029238-1029260 CTTCAGTTGACATCCAAATCTGG - Intergenic
1035699160 8:1625212-1625234 TTCCTATTATCATCCAAAACAGG + Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037773851 8:21819782-21819804 CTTCTGGTGCCATCCAAACTGGG - Intergenic
1040051813 8:43022483-43022505 TTTCTGTTTTCCTTCTAACCAGG + Exonic
1041577450 8:59415355-59415377 TTTCTGCTGTCATCCCCACTTGG - Intergenic
1042216057 8:66430170-66430192 TTTCTCTTGCCACCCAAGCCAGG - Exonic
1042528172 8:69787432-69787454 GTCATGTTATCATCCAAACCGGG - Intronic
1044762293 8:95533530-95533552 TTGCTTTTGTCACCCAAGCCGGG - Intergenic
1045174732 8:99710366-99710388 TTTCTGTTGCCATTTATACCAGG + Intronic
1048331957 8:133476701-133476723 CTTCTGGTGTCATGCCAACCTGG + Intronic
1050507318 9:6361587-6361609 TCTCTTTTGTCATACAAATCAGG + Intergenic
1050770486 9:9192476-9192498 TTTCTGTTGGGATTAAAACCAGG - Intronic
1055392103 9:75833961-75833983 TTTCAGCTCTCATCCAAATCAGG - Intergenic
1056207670 9:84335965-84335987 TTACTGTCATAATCCAAACCAGG - Intronic
1056556244 9:87691106-87691128 GTTCTTCTGACATCCAAACCTGG + Intronic
1058473329 9:105303735-105303757 TTTCTGTTGTCCTCAATTCCAGG - Intronic
1060282235 9:122222329-122222351 TTTCTGTTTTCTTCCAAAAATGG - Intronic
1060313434 9:122485713-122485735 TTTGTTCTGCCATCCAAACCTGG - Intergenic
1185523291 X:757973-757995 TTTCGGTTGTGAGCCATACCAGG - Intergenic
1186206693 X:7207973-7207995 TTTCTGCTGTCCTGCAAACCAGG - Intergenic
1187691932 X:21877472-21877494 TTGCTGTTGTCTTCCAAAAATGG + Intronic
1188884738 X:35535867-35535889 TCTCTATTGTCTTCCAAACTTGG + Intergenic
1189863009 X:45292522-45292544 TTTCATTTATCATCCAAACCAGG + Intergenic
1195202243 X:102563273-102563295 TTGCTGCTGTCAGCCATACCTGG - Intergenic
1199047130 X:143187917-143187939 TATCTGTTGTCCTCCAGACTAGG - Intergenic
1200014972 X:153153630-153153652 TTTTTGGTGTAATCCAAAACAGG + Intergenic