ID: 1090832298

View in Genome Browser
Species Human (GRCh38)
Location 11:130428089-130428111
Sequence CAGCACGAAGCCCTTGCCGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090832298 Original CRISPR CAGCACGAAGCCCTTGCCGA AGG Exonic
900357420 1:2271538-2271560 CAACACAAAGCCCCTGCCGAGGG - Intronic
900874312 1:5330823-5330845 CAGCACCAAGCCCTTGTTCAAGG - Intergenic
906219789 1:44069590-44069612 CAGCACGAAGCCATTCATGAGGG + Intergenic
907709096 1:56861480-56861502 CAGCACTAAGCCTTTCCTGAGGG + Intronic
912761011 1:112367557-112367579 CAGCATTAAGCCATTGGCGAGGG - Intergenic
917120828 1:171643252-171643274 CAGCACCAAGTCCCTGCCGGAGG - Intronic
920533326 1:206721104-206721126 CAGCACCAAGCCATTCACGAGGG - Intronic
922464633 1:225838706-225838728 TACCCCGAAGCCCTTGCTGATGG + Exonic
1064919729 10:20503483-20503505 CAGCAAGAAGCACTCGCTGAGGG + Intergenic
1074304864 10:112267740-112267762 CAGGGAGAAGCCCTTGCAGAGGG + Intergenic
1076378634 10:130009987-130010009 CAGCACCAAGCCATTCACGAGGG - Intergenic
1076594837 10:131619038-131619060 CAGCAGGAAACACTGGCCGATGG - Intergenic
1077301088 11:1847261-1847283 CAGGACGCAGGCCTTCCCGATGG - Intergenic
1084370291 11:68737487-68737509 CATCACGAAGCCATGCCCGATGG + Intronic
1089960525 11:122613776-122613798 CAGCACCAAGGCCATGCGGAAGG - Intergenic
1090832298 11:130428089-130428111 CAGCACGAAGCCCTTGCCGAAGG + Exonic
1091316305 11:134616288-134616310 CAGCACCAAGCCATTGACGAGGG - Intergenic
1091530576 12:1351006-1351028 CAGCACCAAGCCATTCCTGAAGG + Intronic
1091587900 12:1826689-1826711 CAGCAGGCTGCCCTTGCCGGGGG + Intronic
1092528323 12:9324331-9324353 CAGCAGGCAGCCCATGTCGAGGG + Intergenic
1103614286 12:122142321-122142343 CAGCACCCAGCCCTTGTGGATGG + Exonic
1108196942 13:48004278-48004300 CAGCACCAAGCCCTTCATGAGGG - Intergenic
1114459014 14:22875210-22875232 GAGCAGGAAGCCCTGGCCCATGG - Exonic
1116417844 14:44699651-44699673 CAGCACCAAGCCATTCCTGAGGG - Intergenic
1116543806 14:46136544-46136566 CTGCTGGAAGCCCTTGCAGAAGG + Intergenic
1120724512 14:87922868-87922890 CAGCACCAAGCCATTCCTGATGG + Intronic
1121732547 14:96196702-96196724 CAGCACCAAGCCATTCCTGAGGG + Intergenic
1122362433 14:101175339-101175361 CAGAACCCAGCCCTTGCCCAGGG + Intergenic
1124202932 15:27693878-27693900 CAGCAAGGAGCCCTTACCAAAGG + Intergenic
1127205957 15:56719251-56719273 CAGCACCAAGCCATTGGTGAGGG - Intronic
1128664877 15:69530852-69530874 CAGCCCGAAGCCCTGGCTGATGG + Intergenic
1129331206 15:74828304-74828326 CAGCACAAAGCCCTGGCCCTTGG - Intronic
1130157446 15:81363864-81363886 CAACACCAAGCCCTTGCCAAAGG - Intronic
1132912845 16:2324406-2324428 CAGCAAGGAGCCCCTGCCGCTGG - Exonic
1133918378 16:10129961-10129983 GAGCTAGAAGCCCTTGCTGATGG + Intronic
1135422675 16:22315441-22315463 CAGCAAGATGCCCATGCCCAGGG - Intronic
1136358860 16:29764641-29764663 CAGCAAGAAGCCCCTGAAGAAGG - Intergenic
1136564554 16:31062139-31062161 CTGCGTGAAGCCCTTGCCGCAGG + Exonic
1136777401 16:32879247-32879269 CAGCACGAAGGCCCAGCCCATGG + Intergenic
1136893224 16:33982266-33982288 CAGCACGAAGGCCCAGCCCATGG - Intergenic
1137005323 16:35270390-35270412 CAGCAGGCAGCCCATGTCGAGGG + Intergenic
1138848871 16:60602703-60602725 CAGCACAAAGCCCTTGAGCAGGG + Intergenic
1141600885 16:85125650-85125672 CAGCAAGAAGACCTTGAAGATGG - Intergenic
1142076870 16:88123628-88123650 CAGCGCCAAACCCTTGCCAAAGG + Intergenic
1142218022 16:88839343-88839365 CAGCACAAAGGCCTTGCTCAGGG + Intronic
1142226433 16:88879966-88879988 CAGCACAGAGCCCTGGACGAGGG - Intronic
1142379514 16:89723440-89723462 CAGCAAGAAGGCCTTGCAGCTGG - Exonic
1203079814 16_KI270728v1_random:1141356-1141378 CAGCACGAAGGCCCAGCCCATGG + Intergenic
1145290685 17:21543274-21543296 CAGCACCAAGCCATTCCTGAAGG + Intronic
1145290918 17:21545157-21545179 CAGCACCAAGCCATTCCTGAAGG - Intronic
1147367928 17:39971552-39971574 CAGGACGCAGCCCTTGGGGATGG - Exonic
1150630125 17:66874602-66874624 CAGCACCAAGCCATTCCTGAGGG + Intronic
1151553799 17:74836599-74836621 CAGCACGAAGCCCACCCAGAAGG - Exonic
1152995479 18:402436-402458 CAGCACCACGCCCTAGCAGAAGG + Intronic
1155398759 18:25415758-25415780 CAGCACGATGCCCTTCCCTCTGG + Intergenic
1157480189 18:48048936-48048958 CAGAACGAAGCCCATGCCCCAGG + Intronic
1159950573 18:74479715-74479737 CAGTGCGAACCCCTAGCCGAGGG - Intergenic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1165342878 19:35225068-35225090 CTGCACGAAGCACTTGTAGACGG + Exonic
1166283471 19:41809996-41810018 CAGCCCCAAGCCCTTGCCCCTGG + Exonic
1166809587 19:45507506-45507528 CAGCGCGCACCCCTTGCCGGTGG - Exonic
1168706236 19:58471874-58471896 CAGCACGGCGCCCTTGGCGAAGG - Exonic
927674864 2:25097929-25097951 CAGGACCAAGCCCTGGCGGATGG + Intronic
928429389 2:31205262-31205284 CAGCAGGGAGCCACTGCCGATGG + Exonic
937088023 2:119184740-119184762 CAGCACGAGGCCATTGCCACTGG + Intergenic
937426472 2:121803773-121803795 CAGCACCAAGCCCTTTATGAAGG - Intergenic
938652974 2:133402583-133402605 CAGCACCAAGCCATTGATGAGGG - Intronic
939833600 2:147101723-147101745 CAGCACGAAGCCATTCATGAGGG + Intergenic
942772887 2:179543798-179543820 CAGCACTAAGCCCTGACAGAGGG + Intronic
945867361 2:215191212-215191234 CAGCACTAAGCCCTTTAAGAAGG + Intergenic
948298681 2:236885430-236885452 CAGAACGAAGCCAGTGCAGATGG + Intergenic
1174124931 20:48297354-48297376 CAGCCAGAAGCCCCTGCTGAAGG - Intergenic
1176040097 20:63060744-63060766 CAGGAAGAAGCCCTGGCCCAGGG + Intergenic
1180145991 21:45919145-45919167 CAGCACGAAGCACTTCCGGTGGG - Intronic
1181028687 22:20139829-20139851 CAGCACGTAGACCAGGCCGAAGG - Exonic
1184258233 22:43299268-43299290 CAGCACGAAGCCGCTGCTCATGG + Intronic
952853915 3:37752134-37752156 CCACAGGAGGCCCTTGCCGAGGG - Intronic
958506021 3:94978072-94978094 CAGCACCAAGCCCTTCATGATGG - Intergenic
959063963 3:101638957-101638979 CAGCAGGCAGCCCATGCCGACGG - Intergenic
960709277 3:120511248-120511270 CAGCAGGAAGCCATTACAGAAGG + Intergenic
961269619 3:125679493-125679515 CAACAGGTGGCCCTTGCCGAGGG - Intergenic
961496077 3:127292449-127292471 CAGCCCTCAGCCCTTGCAGATGG - Intergenic
961587291 3:127943025-127943047 CAGCACGAAGCCATTTATGAAGG + Intronic
965042733 3:163531859-163531881 CAGCAGGAAGCACTTCCCCAGGG - Intergenic
968135308 3:196216311-196216333 CACCACGAAGCCCCTGCCCTGGG - Intronic
969142518 4:5091157-5091179 CAGTAAGAAGCACTTGCCCAAGG - Intronic
970216746 4:13766909-13766931 GAGGAGGAAGCCCTTGGCGATGG - Intergenic
970434269 4:16018281-16018303 CAGCATGCAGCCCTTGACCATGG + Intronic
979545219 4:121932691-121932713 GCGCACGTAGCCCTTGCTGATGG + Exonic
982038729 4:151373561-151373583 CAGCACTAAGCCATTCACGAAGG + Intergenic
986301052 5:6478767-6478789 CAGCCCTAAGCCCTTGCCTGTGG - Intronic
990308828 5:54518665-54518687 CAGCACGAAGGCCTCCCCGCCGG - Exonic
991243782 5:64488182-64488204 CAGCACCAAGCCATTCACGAGGG + Intergenic
992832727 5:80610583-80610605 CAGCACGAAGCCATTCATGAGGG - Intergenic
999238691 5:150115088-150115110 CAGCCTGCAGCCCTTGCCCAGGG - Exonic
999680990 5:154059940-154059962 CAGCACAATGCCCTTTTCGAAGG - Intronic
1003812709 6:9803042-9803064 AAGGACGAAGCCCTTGCTGATGG - Intronic
1005738315 6:28769281-28769303 CAGCAGGCAGCCCATGTCGAGGG + Intergenic
1006440658 6:34051744-34051766 CTGCAGGAAGCACTTGCAGATGG - Intronic
1007238504 6:40408361-40408383 AACCAAGAAGCCCCTGCCGAGGG - Intronic
1018269496 6:162061412-162061434 CAGTAAGAAGCCCTTTCCAAGGG + Intronic
1022886621 7:34653422-34653444 CAGCACCAAGCCCTTCATGAGGG + Intergenic
1036712017 8:11085807-11085829 CAGCTCGAAGCCACTGCCGCCGG + Intronic
1038940364 8:32297588-32297610 CAGGAAGAAGTCCTTGCCCAGGG + Intronic
1040029747 8:42813673-42813695 CAGCACCAAGCCATTCCTGAGGG - Intergenic
1042405184 8:68396634-68396656 CAGCATGAAGCCCTTCATGAGGG - Intronic
1051802561 9:20952510-20952532 CAGCACCAATCCCTTACCTAAGG - Intronic
1052609409 9:30752734-30752756 CAGCATAAAGCTCTTGCCAATGG - Intergenic
1053477983 9:38395895-38395917 CAGCAAGAAGACCTTCCCGACGG + Exonic
1054792404 9:69268311-69268333 CAGCCCAAAGCCCTTGCCCAGGG + Intergenic
1057792372 9:98132679-98132701 GAGCAGGAAGCGCTTGCCCAAGG + Intronic
1060846473 9:126841731-126841753 CAGGAGGAAGCCCTTACAGAGGG - Intergenic
1062257725 9:135636759-135636781 CAGCACGCAGCCTTTTCAGATGG + Intronic
1189356883 X:40316698-40316720 CAGCACCAAGCCATTCACGAGGG + Intergenic
1189544144 X:42024242-42024264 CAGCACCAAGCCCTTCATGAGGG + Intergenic
1195690535 X:107620798-107620820 CAGCACTAAGCCATTCACGAGGG + Intergenic