ID: 1090835290

View in Genome Browser
Species Human (GRCh38)
Location 11:130449392-130449414
Sequence CGCCGCCGGCGCGCTAGCAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 23}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090835290_1090835300 27 Left 1090835290 11:130449392-130449414 CCAATGCTAGCGCGCCGGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1090835300 11:130449442-130449464 CTCCAGCGCCGGGGTGTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
1090835290_1090835302 30 Left 1090835290 11:130449392-130449414 CCAATGCTAGCGCGCCGGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1090835302 11:130449445-130449467 CAGCGCCGGGGTGTTCCGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 82
1090835290_1090835292 -7 Left 1090835290 11:130449392-130449414 CCAATGCTAGCGCGCCGGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1090835292 11:130449408-130449430 GGCGGCGCAGCGCAACAGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 148
1090835290_1090835297 18 Left 1090835290 11:130449392-130449414 CCAATGCTAGCGCGCCGGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1090835297 11:130449433-130449455 GCACACCTTCTCCAGCGCCGGGG 0: 1
1: 0
2: 0
3: 18
4: 96
1090835290_1090835299 26 Left 1090835290 11:130449392-130449414 CCAATGCTAGCGCGCCGGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1090835299 11:130449441-130449463 TCTCCAGCGCCGGGGTGTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 108
1090835290_1090835293 -6 Left 1090835290 11:130449392-130449414 CCAATGCTAGCGCGCCGGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1090835293 11:130449409-130449431 GCGGCGCAGCGCAACAGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 54
1090835290_1090835295 16 Left 1090835290 11:130449392-130449414 CCAATGCTAGCGCGCCGGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1090835295 11:130449431-130449453 GCGCACACCTTCTCCAGCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 97
1090835290_1090835296 17 Left 1090835290 11:130449392-130449414 CCAATGCTAGCGCGCCGGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1090835296 11:130449432-130449454 CGCACACCTTCTCCAGCGCCGGG 0: 1
1: 0
2: 1
3: 19
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090835290 Original CRISPR CGCCGCCGGCGCGCTAGCAT TGG (reversed) Exonic
914813677 1:151047856-151047878 CGCCGCCGGCGCGCTGCTGTGGG + Exonic
1065636693 10:27742328-27742350 CGGCGCAGGCGCGCAAGCCTCGG - Intronic
1067337963 10:45379595-45379617 CACCGCCTGTGAGCTAGCATGGG - Intronic
1073412040 10:103350604-103350626 CGGCGGCGGCGCACTAGGATCGG + Intronic
1076898573 10:133325920-133325942 CGCCGCCGCCGCCCCAGCCTGGG + Exonic
1077107989 11:850133-850155 CGCCGCCCGCGCGCCCGTATAGG - Intronic
1079459769 11:20669503-20669525 CGCCGCCGCCGCGCCAGCGGTGG + Intergenic
1090835290 11:130449392-130449414 CGCCGCCGGCGCGCTAGCATTGG - Exonic
1095753022 12:45730512-45730534 CGCCGCTGCCGCTCTAGCACAGG + Intronic
1100869545 12:98895334-98895356 GGCCGCCGGGGCGGTAGCAGCGG + Intronic
1104697103 12:130872025-130872047 CGACGCCGGCGCGAGAGCAGGGG - Exonic
1105349500 13:19602439-19602461 CGCCGCCGGGGCGCCAGCGCTGG + Intergenic
1113437795 13:110307023-110307045 CGCCTCGGGCGCGCCACCATGGG - Exonic
1131079644 15:89523906-89523928 GGCCGCCAGCAGGCTAGCATGGG - Intergenic
1152363683 17:79843656-79843678 CGCCGCCGCCGCGCTCACAACGG + Intergenic
1162341905 19:10096372-10096394 CGCCGCCAGCTCGCTGGCGTTGG + Exonic
1167495813 19:49818249-49818271 CGCCGCGCGCGCGCTCGCGTCGG - Intergenic
927811883 2:26185024-26185046 CGCCCCCGGCCCGCTAGCGCCGG + Exonic
948487206 2:238288582-238288604 CGCCGCCGGCGCGCGGGCCTCGG - Exonic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
960628337 3:119702999-119703021 GGCCGCCGGCGCGCAGGGATAGG - Intergenic
973613643 4:52659209-52659231 CCCCGCCAGCGCGCCACCATGGG - Exonic
1001948135 5:175797139-175797161 CGCCGCCGCGGTGCTAGCGTTGG - Intronic
1002352056 5:178590170-178590192 CGCCACCGGCGCGCTCGCCTGGG + Exonic
1006752589 6:36387884-36387906 CGCTGCCCGCTCGCTAGCCTGGG + Intergenic
1030659604 7:112205833-112205855 CGCGGCCGGCCCGCTAGCTTCGG - Intronic
1038157265 8:25001710-25001732 CGCCGCCCGCGCGCCAGGCTTGG + Intergenic