ID: 1090837242

View in Genome Browser
Species Human (GRCh38)
Location 11:130462425-130462447
Sequence TGGCTAGCCCAGAATCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090837242_1090837247 16 Left 1090837242 11:130462425-130462447 CCATTCAGATTCTGGGCTAGCCA 0: 1
1: 0
2: 0
3: 31
4: 220
Right 1090837247 11:130462464-130462486 CTCATCCTAACGAACGCCCTCGG 0: 1
1: 0
2: 0
3: 2
4: 34
1090837242_1090837249 27 Left 1090837242 11:130462425-130462447 CCATTCAGATTCTGGGCTAGCCA 0: 1
1: 0
2: 0
3: 31
4: 220
Right 1090837249 11:130462475-130462497 GAACGCCCTCGGCTCTCTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090837242 Original CRISPR TGGCTAGCCCAGAATCTGAA TGG (reversed) Intronic
902415202 1:16234490-16234512 TGTCCAGCCCAGGATCTGATGGG - Intronic
904197903 1:28799773-28799795 TGGCAAGTCCAAAATCTGTAGGG + Intergenic
904596030 1:31645988-31646010 AGGCTGGGCCAGATTCTGAAGGG - Intergenic
905391902 1:37641372-37641394 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
905552626 1:38855721-38855743 TTTCTAGCCCAGCATCTGCAAGG + Exonic
909972463 1:82006956-82006978 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
910037277 1:82803559-82803581 TGGCTAACCCAGAGGCAGAAGGG + Intergenic
910538614 1:88329149-88329171 TGGCAAGTCCAAAATCTGATGGG + Intergenic
911744162 1:101420772-101420794 TGGCAAGTCCAAAATCTGATAGG - Intergenic
912498463 1:110106475-110106497 TGGGTAGTCCAATATCTGAAAGG - Intergenic
912876972 1:113370269-113370291 TTACTAGCCCTAAATCTGAAAGG + Intergenic
912972527 1:114297414-114297436 TGGCAAGTCCACAATCTGTATGG - Intergenic
913144404 1:115976012-115976034 TGGCTAGCACAGAATAGGACTGG + Intergenic
913392681 1:118331964-118331986 TGGCAAGCCGAAAATCTGAAAGG + Intergenic
913519755 1:119633458-119633480 TGGCAAGTCCAAAATCTGTAGGG + Intronic
914949332 1:152098447-152098469 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
916847572 1:168668794-168668816 TGGCTAGTTCAAAATCTGTAGGG - Intergenic
916979801 1:170121747-170121769 TGGCAAGTCCAAAATCTGGAAGG - Intergenic
918085075 1:181238219-181238241 TGGCTAAACCAGAAACTGGAGGG + Intergenic
920435683 1:205945431-205945453 TGGGTAGCCCAGAATGTCCATGG - Intergenic
921052333 1:211519843-211519865 TGGCTGGCACAGATGCTGAAAGG + Intergenic
921601769 1:217113694-217113716 TGCCTGGCCCAGATTCTTAAAGG - Intronic
1063548996 10:7010804-7010826 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1064969358 10:21048642-21048664 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1067966102 10:50914552-50914574 TGGCTAGGACAGATTCTGATTGG + Intergenic
1068550323 10:58400624-58400646 TAGCTGGGCCAGAATCTGGAGGG + Intergenic
1068583575 10:58771208-58771230 TGGCTGTGCCAGAGTCTGAAGGG + Intronic
1069266609 10:66466225-66466247 TGGCAAGCCCAGAATATGCAGGG - Intronic
1070502410 10:77084104-77084126 TGTCTGGCCCAGAATGTTAATGG - Intronic
1070641704 10:78175156-78175178 TGGAGAACCCAGAATCTGGAAGG - Intergenic
1073510047 10:104037168-104037190 TCACTATTCCAGAATCTGAAAGG + Intronic
1073547390 10:104362540-104362562 TTTCTGGCCTAGAATCTGAAGGG - Intronic
1075704549 10:124492399-124492421 TGGCGAGTCCAAAATCTGCAGGG + Intronic
1077971848 11:7201703-7201725 AGGGTAGACAAGAATCTGAAGGG - Intergenic
1080787567 11:35489605-35489627 TGGCAAGCCCTGACTATGAAGGG - Intronic
1080863050 11:36167121-36167143 TAGCTAGTCCAAAATCTGCAGGG + Intronic
1081597280 11:44467756-44467778 GGGCTATCCCAGGAGCTGAAAGG - Intergenic
1081779898 11:45702949-45702971 GGCCTGGCCCAGAATCTGATTGG - Intergenic
1085577738 11:77621959-77621981 TGGCAAGTCCAAAATCTGCATGG - Intronic
1086373711 11:86179589-86179611 TGGCAAGTCCAAAATCTGCAAGG + Intergenic
1086986710 11:93258569-93258591 TGGTTATCTCAGATTCTGAAAGG - Intergenic
1088234557 11:107708464-107708486 TGGCAAGTCCAAAATCTGCAGGG - Intronic
1088942184 11:114470674-114470696 TGGCAAGTCCAAAATCTGTAGGG + Intergenic
1089132526 11:116223873-116223895 GAGCAAGCCCAGAATCTGACTGG + Intergenic
1090837242 11:130462425-130462447 TGGCTAGCCCAGAATCTGAATGG - Intronic
1090901723 11:131037999-131038021 TGTGTAGCCCAGGAACTGAAGGG - Intergenic
1092968135 12:13665323-13665345 TGGTTAGCCCAGACTGTGACTGG - Intronic
1094241003 12:28224841-28224863 TGGCTAGCGCAGAATTACAACGG + Intronic
1094354657 12:29565100-29565122 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1094464226 12:30734771-30734793 TGGCTGGCCCAGAGTCTGACAGG - Intronic
1095533342 12:43217203-43217225 TGGATAGCAGAGAATCTTAACGG - Intergenic
1095731814 12:45513726-45513748 TGGCAAGTCCAAAATCTGCATGG - Intergenic
1098844168 12:75515175-75515197 TGGCGAGTCCAAAATCTGCACGG - Intergenic
1100198437 12:92273279-92273301 TGGCAAGTCCACAATCTGATGGG - Intergenic
1100608889 12:96174400-96174422 TAGCTAGAACAGAATTTGAATGG - Intergenic
1100840715 12:98609356-98609378 TGGCAAGTCCAAAATCTGCAAGG - Intergenic
1102774923 12:115510224-115510246 TGGCAAGTCCATAATCTGGAGGG - Intergenic
1102869792 12:116404973-116404995 TGGCAAGCCCAAAATCTGCAAGG + Intergenic
1103688011 12:122747803-122747825 TGGCAAGTCCCAAATCTGAAGGG - Intergenic
1104284357 12:127411216-127411238 TGGCAAGCACAGATTCTGGATGG + Intergenic
1104377656 12:128278991-128279013 TGGCAAGTCCAAAATCTGTAGGG - Intronic
1105782837 13:23719542-23719564 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1106476710 13:30105343-30105365 TGCCAAGCCAAGAATCTGCATGG - Intergenic
1107313934 13:39110799-39110821 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1109570513 13:64182816-64182838 TGGCAAGTCCAAAATCTGTAGGG - Intergenic
1109876375 13:68409225-68409247 TGGCTAGCTCAGAATCAGTGGGG + Intergenic
1111090082 13:83434467-83434489 TGGATTTCCCAGCATCTGAATGG + Intergenic
1118204664 14:63711470-63711492 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1121425167 14:93845510-93845532 TGTCTAGTCCAAAATCTGCAGGG - Intergenic
1122725483 14:103748006-103748028 TGGCAAGTCCAGAATCTGTGAGG - Intronic
1123487445 15:20754863-20754885 TGAACAGCCCTGAATCTGAAAGG + Intergenic
1123596117 15:21914600-21914622 GGGCTTGCCCAGAACCTGAGGGG + Intergenic
1124479307 15:30063993-30064015 TGGCAAGTCCAGAATCTGTAGGG - Intergenic
1124499314 15:30212820-30212842 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1124744265 15:32325842-32325864 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
1124989581 15:34658306-34658328 TGGCAAGCTCAAAATCTGCAGGG + Intergenic
1125740079 15:41956327-41956349 TCCCTGGCCCGGAATCTGAAGGG - Intronic
1128610131 15:69066579-69066601 TGGCTACCTCAGAATCTTCATGG - Intergenic
1129360086 15:75019160-75019182 TGCCAAGAGCAGAATCTGAAAGG - Exonic
1131153023 15:90058789-90058811 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1131807904 15:96142180-96142202 TGGCTGGCCCAAAATGTGACTGG - Intergenic
1132297496 15:100751657-100751679 TGGCATGTCCAGAATCTGCAGGG + Intergenic
1202952278 15_KI270727v1_random:51199-51221 TGAACAGCCCTGAATCTGAAGGG + Intergenic
1133623510 16:7549005-7549027 TGGCTAGCCCAGATGGTGATAGG + Intronic
1135067446 16:19322424-19322446 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
1138824368 16:60301084-60301106 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
1138926694 16:61600310-61600332 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
1139490312 16:67282413-67282435 TGGCTAGCTCAGAACCTGGTAGG + Intronic
1139613362 16:68074591-68074613 TGGCTAGGCCAGCTTGTGAAGGG - Intronic
1140593162 16:76377034-76377056 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1141050655 16:80760317-80760339 TGGCTATCACAGACTGTGAAGGG + Intronic
1144101715 17:11947738-11947760 TGGCCAGCCCAGAATCTGGGAGG + Intronic
1148579911 17:48736349-48736371 TGGCTGGCCCAGAACCTTGAGGG - Intergenic
1150936444 17:69640915-69640937 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1151900147 17:77007032-77007054 TGGCCAGCTCAGCCTCTGAAGGG - Intergenic
1153789249 18:8562967-8562989 AGACAAGCCCAGACTCTGAAGGG + Intergenic
1153910081 18:9699009-9699031 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1155234701 18:23807562-23807584 TGGCAAGTCCAAAATCTGCAAGG + Intronic
1155981525 18:32185140-32185162 TGGCAAGTCCAAAATCTGCAGGG - Intronic
1156402486 18:36752381-36752403 TGTCTAGCCCAGAATGGGAGGGG - Intronic
1156712521 18:39963959-39963981 GGGATAGCTCAGAATCTGGAAGG - Intergenic
1157471181 18:47990232-47990254 TGGCAAGTCCAAAATCTGCAAGG + Intergenic
1157669646 18:49517546-49517568 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1157689834 18:49672457-49672479 TGGTGAGCCCAAAATCTGATGGG + Intergenic
1158275076 18:55758253-55758275 TGTGTAGCTCAGAATTTGAATGG - Intergenic
1158649240 18:59272224-59272246 TGGCATGCCCAGAGTCTCAAGGG - Intronic
1160180760 18:76634039-76634061 TGGCTACTCCAAAATCTGCAGGG - Intergenic
1161731550 19:5964018-5964040 TGGCCTGGCCAGAAACTGAAAGG + Intronic
1165556013 19:36632898-36632920 TTGCTAGACCAGAAACTGAGTGG - Intergenic
1166046076 19:40231998-40232020 TGGGTAGCCCAGAATGAGGAGGG - Exonic
1167180502 19:47899604-47899626 TGGCAAGTCCAAAATCTGTAGGG - Intergenic
1168655112 19:58121836-58121858 AGTCCATCCCAGAATCTGAAAGG + Intergenic
925166790 2:1720504-1720526 TGGCAAGTCCAGAGTCTGCAGGG + Intronic
926441410 2:12892638-12892660 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
927381832 2:22488305-22488327 AGGATAGCCTAGAATCTGAAAGG + Intergenic
927398742 2:22686324-22686346 TGACTAGTCCAAAATCTGTAGGG - Intergenic
927431154 2:23027167-23027189 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
933090670 2:78112018-78112040 TGGCTGGCCCAGAAGCAGCAGGG + Intergenic
936348730 2:111696400-111696422 TGGCAAGCCCAAAATCTGCAAGG + Intergenic
936648163 2:114395735-114395757 AGGCTAGCCAACCATCTGAATGG - Intergenic
939197279 2:138988626-138988648 TGGGTTTCCCAGAATTTGAAGGG - Intergenic
940494056 2:154403158-154403180 TGCCTGGCCTAAAATCTGAAAGG - Intronic
944316062 2:198286930-198286952 TGGCAAGTCCAAAATCTGGAGGG - Intronic
945772470 2:214061451-214061473 TGGCTAGTCCAAAATCTCCAGGG + Intronic
946060658 2:216938284-216938306 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
947587587 2:231366102-231366124 TGGCAAGCGCAGAATCTGATGGG + Intronic
1170530523 20:17286941-17286963 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1170544800 20:17426596-17426618 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1173475578 20:43356779-43356801 TGCCTAGCCCAGAAGCTGGAGGG - Intergenic
1174705408 20:52650386-52650408 TGGCAAGTCCAAAATCTGTAGGG - Intergenic
1174720698 20:52809106-52809128 AGGCCAGCCCAGAATTGGAATGG + Intergenic
1175864818 20:62169803-62169825 TGGCTGTCACAGAAACTGAAAGG + Intronic
1176785712 21:13253722-13253744 CCGCTAGCCCAGAATCCAAAAGG - Intergenic
1177151339 21:17458425-17458447 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1178121516 21:29474520-29474542 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1178153705 21:29826591-29826613 TGGCAAGCCCAAAATCTGCAGGG - Intronic
1178884320 21:36473390-36473412 TGGCAAGTCCAAAATCTGCAGGG - Intronic
1179140965 21:38724871-38724893 TGGCAAGTCCAAAATCTGTAGGG + Intergenic
1182380703 22:29884439-29884461 TGAACAGCCCTGAATCTGAAAGG - Intronic
1183376762 22:37469816-37469838 TGGCAAGCCCAGGATCTGAGTGG - Exonic
1184598433 22:45528127-45528149 TGGCAAGTCCAAAATCTGCAGGG + Intronic
949113545 3:292687-292709 TGGCTTCCCCAGAAGCTGAGCGG - Intronic
950740775 3:15050261-15050283 TGGACAGCCCAGACCCTGAAAGG - Exonic
951621128 3:24603221-24603243 AGGAGACCCCAGAATCTGAAAGG + Intergenic
951784001 3:26397928-26397950 AAGCAAGCCCAGAATCAGAATGG + Intergenic
952752446 3:36836161-36836183 TGGCTATCCCAGAAAGCGAAGGG + Intronic
953201047 3:40779075-40779097 TGACTAGCTCTGAATCAGAAAGG + Intergenic
953547746 3:43876153-43876175 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
955094899 3:55787502-55787524 TGTCTAGCCCTGTATCTGAATGG - Intronic
957317589 3:78588199-78588221 TGTCTCTCCCAGAATATGAAAGG + Intergenic
958931687 3:100214453-100214475 TGGCAAGTCCAAAATCTGACAGG + Intergenic
959865638 3:111266854-111266876 TGGCAAGCCCAAAACCTGGATGG - Intronic
961084655 3:124056442-124056464 TGGCCTGCCCAGAATCAGAAAGG - Intergenic
961993080 3:131213111-131213133 TGGCAAGTCCAAAATCTGCAAGG - Intronic
963276010 3:143330345-143330367 CAGCTAGCTCAGAATCTGAAAGG + Intronic
966675103 3:182577052-182577074 TGGTGAGCCCAGAGGCTGAATGG - Intergenic
966902420 3:184496338-184496360 TGGCAAGTCCAAAATCTGCAGGG - Intronic
969429649 4:7146685-7146707 TGGCCAGTCCAAAATCTGCAGGG - Intergenic
970483046 4:16496968-16496990 GGACAAGCCCAGAATCTGTAGGG - Intergenic
970662956 4:18306642-18306664 TGGCAAGGCCAAAATCTGCAGGG - Intergenic
970872905 4:20836519-20836541 TGGCAAGTCCAAAATCTGTAGGG + Intronic
970928324 4:21479148-21479170 GGGCCAGCCCAGTATCTGCAGGG + Intronic
971935883 4:33146599-33146621 TGGCTAGTCTAAAATCTGCAGGG + Intergenic
973581472 4:52348494-52348516 GGGGTTGCCCAGATTCTGAAGGG - Intergenic
974132530 4:57774337-57774359 TAGCAAGTCCAAAATCTGAAGGG + Intergenic
975539571 4:75492839-75492861 TGGCTAGTCCAAAATCTCAAGGG - Intronic
976121563 4:81789246-81789268 TGGTAAGTCCAGAATCTGCAAGG + Intronic
976753026 4:88469501-88469523 TGGCAAGTCCAAAATCTGTAGGG + Intronic
977899628 4:102404680-102404702 TGGCAAGACCAAAATCTGTAGGG + Intronic
981239154 4:142454283-142454305 TGGCAAGGGCAGAATGTGAAAGG - Intronic
981574910 4:146194263-146194285 AGGCAAGCCCAAAATCTGCAGGG + Intronic
981642513 4:146961140-146961162 TGGCAAGCACAGAATTAGAAAGG - Intergenic
982314041 4:154013032-154013054 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
983162430 4:164432956-164432978 TGACTAGTCCAGAATCTGCAAGG + Intergenic
984950451 4:185003999-185004021 TGGCAAGCCCCAAATCTGCAGGG + Intergenic
985671736 5:1210312-1210334 GGGCTACTCCAGAATCTGAGGGG - Intronic
986454720 5:7904790-7904812 TGGCTGGGCCAGAATCTTAAAGG + Intronic
986803675 5:11287385-11287407 TGGCAAGTCCAAAATCTGCAGGG - Intronic
987661379 5:20882626-20882648 TGGCAAGTCCAAAATCTGCAAGG + Intergenic
988762206 5:34322699-34322721 TGGCAAGTCCAAAATCTGCAAGG - Intergenic
990496859 5:56357055-56357077 TGGTTTCCCCAGAACCTGAATGG + Intergenic
992925998 5:81587900-81587922 TGGCAAGCCCAGAAAATGATTGG - Intronic
994746297 5:103682485-103682507 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
995138281 5:108703890-108703912 TGGCAAGCCCAAAATCTGGAGGG - Intergenic
996316578 5:122167140-122167162 TGGCTAGCCAAGAAACTGGTCGG + Intronic
996425223 5:123306625-123306647 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
996851215 5:127954879-127954901 TGGCAAACCCAAAATCTGTAAGG + Intergenic
997391151 5:133517700-133517722 TGGCAAGTCCAAAATCTGCAGGG + Intronic
997393814 5:133540165-133540187 TGGCAAATCCAGAATCTGATGGG - Intronic
997707768 5:135974687-135974709 TGGCAAGCCCAAACTCTGCAGGG + Intergenic
1001260403 5:170223564-170223586 TGGCTAGCCAAGAAAGTGGATGG - Intergenic
1003268367 6:4586502-4586524 TGGCTAACCCAAAATCTGCAGGG + Intergenic
1004161823 6:13221118-13221140 TCTCTAGGCCAAAATCTGAAGGG + Intronic
1008348053 6:50453956-50453978 GGCCTAGCCCAGAGTCTGAGTGG + Intergenic
1008609039 6:53169018-53169040 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
1009439406 6:63658832-63658854 TGGCAAGCCCAAAATCTGCAGGG + Intronic
1009447726 6:63763227-63763249 TGGCTAGAGCAGAAGCTGAGGGG + Intronic
1009474003 6:64064647-64064669 AGGCTATCTCAGAATCTGAATGG + Intronic
1010175372 6:73021941-73021963 TGATTAGCCCAGACTCAGAAGGG - Intronic
1014578362 6:123102675-123102697 TGGCAAGTCCACAATCTGCATGG - Intergenic
1014641000 6:123910286-123910308 TGGCTAACAAAGAATCTGCATGG - Intronic
1015217804 6:130770093-130770115 TGGCAAGTCCAAAATCTGTAAGG - Intergenic
1015681547 6:135814194-135814216 TGGCCAGTCCAAAATCTGCAGGG + Intergenic
1017321965 6:153105008-153105030 TGGCCAGAGCAGAATCAGAAAGG + Intronic
1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG + Exonic
1019563374 7:1668530-1668552 TGGCCAGGCCAGAAGCTGGAGGG + Intergenic
1020755916 7:12202842-12202864 TGGTGAGTCCAAAATCTGAAGGG - Intergenic
1022220489 7:28309153-28309175 TGGCAAGTCCAAAATCTGCAGGG - Intronic
1022455186 7:30552488-30552510 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1023994735 7:45152350-45152372 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1024039302 7:45538102-45538124 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1024345284 7:48307055-48307077 TGGCAAGCCCAAAATCTGCAGGG - Intronic
1026198651 7:68195024-68195046 TGGCAAGTCCAAAATCTGTAAGG + Intergenic
1027379646 7:77593424-77593446 TGGCCAGTCCAAAATCTGCAGGG + Intronic
1032352340 7:131176638-131176660 TGGCCAGCACAGTAGCTGAATGG - Intronic
1034128119 7:148692163-148692185 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
1034178966 7:149123262-149123284 TTTATAGCACAGAATCTGAAAGG - Intronic
1035032834 7:155873256-155873278 TGACCAGCTCAGAAGCTGAAAGG - Intergenic
1036168102 8:6456822-6456844 GGGATAGCCCTGAATCTGATGGG + Intronic
1036654431 8:10668163-10668185 TGGCAAGTCCAAAATCTGTAGGG + Intronic
1036941043 8:13052284-13052306 TGGCAAGTCCAAAATCTGCAAGG + Intergenic
1038307991 8:26421893-26421915 TGGCAAGACCAAAATCTGCAAGG + Intronic
1042056795 8:64772527-64772549 TGGCAAGTCCAAAATCTGCAGGG - Intronic
1042625359 8:70751091-70751113 TGGCAAGCCCAAAATCAGCAGGG - Intronic
1044333472 8:90947934-90947956 TGGCTAGCCTGGAAAATGAAAGG + Intronic
1044459077 8:92423902-92423924 TGGATAGCTCAGAATATGATTGG + Intergenic
1048454524 8:134565895-134565917 TTGCTGGCCCAGAATATCAAGGG + Intronic
1048889913 8:138937593-138937615 TGGCAAGTCCAGAATCTGTAGGG - Intergenic
1049700693 8:144010472-144010494 TGGCAAGTCCAAAATCTGTAAGG + Intronic
1050429877 9:5551588-5551610 TGTCTAGCCCAGCAGCAGAATGG - Intronic
1051652171 9:19338834-19338856 TGGCAAACCCAGAGTCTGAGTGG + Intronic
1053205780 9:36185031-36185053 TGGCAAGTCCAGAATCTGCAGGG - Intergenic
1055426669 9:76203848-76203870 TTACTATCACAGAATCTGAAGGG + Intronic
1055987923 9:82071382-82071404 TGGCAAGTCCAAAATCTGAAGGG - Intergenic
1056443562 9:86643482-86643504 TGGCGGGGCCAGGATCTGAAGGG + Intergenic
1186183288 X:6993530-6993552 TGGCTTTCCCAGAGTCTGAGAGG - Intergenic
1187514093 X:19950391-19950413 AGACTAACCCAGAATCTAAAGGG + Intronic
1187527988 X:20071309-20071331 TGACTAGATCAGAATCTGAAGGG - Intronic
1188065586 X:25655761-25655783 TGGCCAGCCCAGATTCTGAGGGG + Intergenic
1188423807 X:30023242-30023264 TGGCAAGTCCAGAATCTGCAGGG - Intergenic
1189363964 X:40374014-40374036 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
1191038833 X:56057287-56057309 TGGCAAGCACAGAATCAGCAAGG - Intergenic
1192781502 X:74297847-74297869 TGGCAAGTCCAAAATCTGCAAGG - Intergenic
1192790860 X:74380586-74380608 TGCCAACCCCAGACTCTGAAGGG + Intergenic
1194334423 X:92627800-92627822 TGGCCAGCCCAAAGTCTGAACGG - Intergenic
1194560862 X:95418140-95418162 TGGCAAGTCCAAAATCTGACAGG + Intergenic
1194651860 X:96524660-96524682 TGGCAAGGCCAAAATCTGCAGGG + Intergenic
1195280022 X:103323368-103323390 TGACAAGCCCAAAATCTGCAGGG - Intergenic
1195733089 X:107985586-107985608 TGGCAAGTCCAAAACCTGAATGG + Intergenic
1199574436 X:149299765-149299787 TGGCTAGCCCAAAATCAAACTGG - Intergenic
1199591734 X:149473987-149474009 TGGATAGCCCAGAAACTCTATGG - Intergenic
1200642898 Y:5744850-5744872 TGGCCAGCCCAAAGTCTGAACGG - Intergenic