ID: 1090838527

View in Genome Browser
Species Human (GRCh38)
Location 11:130470972-130470994
Sequence GAGTGAGCCGGTTGGTGCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090838527_1090838531 -9 Left 1090838527 11:130470972-130470994 CCACAGCACCAACCGGCTCACTC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1090838531 11:130470986-130471008 GGCTCACTCTCGCCGTGGCATGG 0: 1
1: 0
2: 0
3: 6
4: 55
1090838527_1090838534 8 Left 1090838527 11:130470972-130470994 CCACAGCACCAACCGGCTCACTC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1090838534 11:130471003-130471025 GCATGGGTGCCCAAGTACTCCGG 0: 1
1: 0
2: 0
3: 13
4: 126
1090838527_1090838538 22 Left 1090838527 11:130470972-130470994 CCACAGCACCAACCGGCTCACTC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 22
1090838527_1090838532 -8 Left 1090838527 11:130470972-130470994 CCACAGCACCAACCGGCTCACTC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1090838532 11:130470987-130471009 GCTCACTCTCGCCGTGGCATGGG 0: 1
1: 0
2: 0
3: 0
4: 53
1090838527_1090838537 21 Left 1090838527 11:130470972-130470994 CCACAGCACCAACCGGCTCACTC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1090838537 11:130471016-130471038 AGTACTCCGGCGTGTCTCCCCGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090838527 Original CRISPR GAGTGAGCCGGTTGGTGCTG TGG (reversed) Exonic
900353733 1:2249690-2249712 CAGTGAGTCGGTTGGAGCAGGGG - Intronic
901100011 1:6712686-6712708 AAGTAAGCTGGTTTGTGCTGCGG - Intergenic
901575120 1:10194510-10194532 GAGAGAGCTGGTTGATGCTCAGG + Intergenic
902743938 1:18460481-18460503 GAGCGAGGCTGTTGGTGCAGTGG - Intergenic
903499395 1:23793169-23793191 GAGGGAGCCGGATGGTGGAGAGG - Exonic
904351193 1:29907889-29907911 GAAAGAGGAGGTTGGTGCTGTGG + Intergenic
905124420 1:35707353-35707375 GACTGAGCAGGTTGTGGCTGCGG + Intergenic
905173438 1:36122608-36122630 GAGTAAGCCGGTTGGCGATGGGG - Intronic
906064059 1:42967424-42967446 GTGTGAGCTGGCTGGAGCTGGGG + Intergenic
912388236 1:109283259-109283281 AAGTCAGCCGGTGGGGGCTGGGG + Intergenic
915214591 1:154331321-154331343 GAGTGAACTGGTTTGTGATGGGG + Intronic
917111970 1:171557802-171557824 GACTGAGGCAGTTGGGGCTGAGG - Exonic
917661014 1:177176844-177176866 GAGTGAGCCGGTGGGTGGCTTGG + Intronic
919810166 1:201404277-201404299 GAGCCAGCTGGTTGGGGCTGGGG - Intronic
919946202 1:202320544-202320566 GAGTGAGGCGGTAAGAGCTGGGG + Intergenic
1067170860 10:43904659-43904681 GATTGAGCAGGATGGTGGTGGGG - Intergenic
1067463702 10:46477948-46477970 AAGTCAGCCCATTGGTGCTGCGG - Intergenic
1067623492 10:47906703-47906725 AAGTCAGCCCATTGGTGCTGCGG + Intergenic
1070328847 10:75404181-75404203 GAGTGAGGCGGTGTGTGCTTGGG + Intergenic
1075069113 10:119308990-119309012 CAGTGAGGAGGCTGGTGCTGAGG + Intronic
1075079284 10:119371886-119371908 GAGTTAGCTGGTTGCTGCCGGGG - Intronic
1077157028 11:1096524-1096546 CGGTGTGCCGGTTGGTGTTGGGG - Intergenic
1077178627 11:1202603-1202625 GGCTGAGCCGGGTGGGGCTGGGG + Intergenic
1086351950 11:85951199-85951221 AAGCGAGCAGGTTGGAGCTGAGG - Intergenic
1090703459 11:129316148-129316170 GGCCGAGCCGGTTAGTGCTGGGG - Intergenic
1090838527 11:130470972-130470994 GAGTGAGCCGGTTGGTGCTGTGG - Exonic
1091624185 12:2110090-2110112 GAGTGAGGGGCTTGGTGCTGGGG - Intronic
1091936001 12:4434943-4434965 GAGAGAGGCGGTTGGTGGAGGGG + Intronic
1094368916 12:29714690-29714712 GAGAGAGCCAGTCAGTGCTGTGG - Intronic
1095475863 12:42587186-42587208 GAGTGAGCCTGTTGGTTCATAGG - Intronic
1097974452 12:65669562-65669584 TAGTCAGCTGATTGGTGCTGTGG - Intergenic
1100543637 12:95580989-95581011 GAGTGAGCCAGTTGCTGCCAGGG - Intergenic
1100889839 12:99112946-99112968 CTGTGAGCCCTTTGGTGCTGAGG - Intronic
1101874201 12:108588135-108588157 GAGGGAGACGGTGGTTGCTGGGG - Intergenic
1102068799 12:110000303-110000325 GAATGAGGATGTTGGTGCTGGGG + Intronic
1103294771 12:119877031-119877053 GGGTCAGCCGAGTGGTGCTGGGG - Intronic
1103484647 12:121274334-121274356 GTGTGAGCCGGGCTGTGCTGTGG - Exonic
1104056818 12:125236984-125237006 GAGTGAGCAGGTCACTGCTGTGG + Intronic
1107986746 13:45782745-45782767 GAGTGCTCAGGTTGATGCTGGGG - Exonic
1116594180 14:46819297-46819319 GGGTGAACCGGGTGGAGCTGCGG + Intergenic
1119763460 14:77171808-77171830 GCCTGAGCAGGTTGGAGCTGTGG - Intronic
1121279788 14:92690219-92690241 GAGTGAGCTGGTTGGTGCCCAGG - Intergenic
1121918056 14:97854263-97854285 GAGCGAGACAGGTGGTGCTGGGG - Intergenic
1122894312 14:104748558-104748580 AAGTGAGTGAGTTGGTGCTGGGG - Intergenic
1124235567 15:27986749-27986771 GAGTGAGGAGCTTGGTGATGTGG - Intronic
1124435753 15:29647871-29647893 GAGTGTGCCTGTTGGTGGAGAGG - Intergenic
1128714853 15:69900660-69900682 GGGTGAGCCAGTTTGTGCAGAGG - Intergenic
1133030296 16:3007681-3007703 GAGTGAGCCAGCTGGTGGAGGGG + Intergenic
1133101651 16:3483656-3483678 CAGTGAGCAAGTTGGAGCTGTGG + Intronic
1136025949 16:27469266-27469288 GAGTGCTCCTGCTGGTGCTGTGG - Intronic
1136050526 16:27646888-27646910 GAGTGAGCTGACTGGTGCTGGGG - Intronic
1137487111 16:48900672-48900694 GAGGGAGCCGGTGGCTGATGTGG - Intergenic
1137734456 16:50713652-50713674 GAGTGAGAGGGTTGGTGCAGGGG + Intronic
1139466399 16:67156250-67156272 GAGTGAGCCGGCTGGTGGAGGGG + Intronic
1140210125 16:72962963-72962985 GAGAGAGCCGGCTGTTGCGGGGG - Intronic
1142252026 16:88996422-88996444 GGGTGAGCAGGATGGGGCTGGGG - Intergenic
1143097739 17:4487474-4487496 GAGTGAGACGGGAGCTGCTGTGG + Intronic
1143321360 17:6070846-6070868 GAGTGAGCGGGTGCGTGCAGGGG + Intronic
1143980009 17:10860814-10860836 GAGTGAGCTGGATGCTACTGTGG - Intergenic
1144021058 17:11240736-11240758 GACGGAGCCGGTTGAGGCTGGGG - Intergenic
1144032367 17:11334209-11334231 GACTGAGCCTGTAAGTGCTGAGG + Intronic
1145077538 17:19867971-19867993 GAGGGAGCCGGCTGGCGCTGCGG - Intergenic
1146562609 17:33884238-33884260 GAGGGAGCAGGTTGGGGTTGGGG - Intronic
1148206257 17:45782160-45782182 GAGGAAGCCGGTTGGTCCTCTGG - Intergenic
1148401647 17:47367504-47367526 GAAGGAGCCGGGTGGAGCTGTGG + Intronic
1150740201 17:67773229-67773251 GGGTGAGCTGGGAGGTGCTGAGG + Intergenic
1152030938 17:77842585-77842607 GAGTGAGTCGGCTGGAGCTGAGG + Intergenic
1152104895 17:78323157-78323179 GAGTGACCCCGCTGGTCCTGGGG - Intergenic
1153713628 18:7823955-7823977 CAGTGAGCAGGTTGGGGCTTGGG - Intronic
1154037733 18:10821707-10821729 GAGGGCGCAGGATGGTGCTGTGG - Intronic
1159101252 18:63961719-63961741 GAGTGAACCAGTAGGGGCTGTGG - Exonic
1160235601 18:77083815-77083837 AAGTGAGCCGGTGATTGCTGAGG + Intronic
1162193596 19:8966387-8966409 TAGTGAGGTGGTTTGTGCTGTGG + Exonic
1162304596 19:9864253-9864275 TAATGAGCAGGTTGCTGCTGTGG - Intronic
1162421073 19:10566300-10566322 GAGTGAGCTGGGTGGGGCAGCGG - Intergenic
1163046733 19:14648476-14648498 GAGTGAGCAGCTTGCTGTTGGGG - Intronic
1165152153 19:33767144-33767166 GAGTGAGCCACCTGGGGCTGGGG + Intronic
1166135623 19:40775502-40775524 GAGTGAGCAAGGGGGTGCTGGGG - Exonic
1166824238 19:45599329-45599351 GAGTGAGCCCAGGGGTGCTGGGG - Intronic
927011746 2:18911433-18911455 TAGTGAGGAGGTGGGTGCTGAGG + Intergenic
931163619 2:59720807-59720829 GGGTGAGCTGGGAGGTGCTGTGG + Intergenic
931461845 2:62456851-62456873 GTGTGAGCCTGGAGGTGCTGAGG + Intergenic
940955175 2:159719383-159719405 GAGTGGGCGGGGTGGTGGTGGGG - Intronic
940991172 2:160098137-160098159 GACTGTGCAGGTTGGTGCTGGGG + Intergenic
946381002 2:219348961-219348983 TGGTGAGCAGGTTGTTGCTGTGG + Intergenic
1170174743 20:13456338-13456360 GAGTGAGCAGGATGTTGTTGTGG - Intronic
1175776384 20:61656396-61656418 GAGTGAGCAGGTGTATGCTGAGG + Intronic
1178664369 21:34533833-34533855 GAGTGAACCGTTGGATGCTGGGG + Intronic
1178712140 21:34927021-34927043 GAATGAGTCGTTTAGTGCTGAGG + Intronic
1179248158 21:39650907-39650929 GAGTGAGGGTGTTGGCGCTGGGG - Intronic
1182304191 22:29356547-29356569 GATCGAGCAGGTTGCTGCTGGGG + Exonic
1182699750 22:32226934-32226956 GAGTGAGCCCCATGGTGCTCTGG - Intronic
1183321429 22:37167311-37167333 GAGGGTGCCGGCTGGGGCTGGGG - Intronic
1184890189 22:47374577-47374599 GAGTGAGCGAGAAGGTGCTGAGG - Intergenic
951980292 3:28558596-28558618 TAATGAGCAGGTTAGTGCTGTGG + Intergenic
952849157 3:37713567-37713589 AACTGAGCTGGTTGGAGCTGGGG + Intronic
952932006 3:38367770-38367792 GAGTGTCCTGGTTGGTTCTGAGG + Intronic
954602084 3:51877899-51877921 GAGTGAGCCTCCTGGAGCTGGGG + Intergenic
956208691 3:66780498-66780520 GAATGAGCAGGTTGCTGCTGTGG - Intergenic
956681290 3:71784665-71784687 GAGTGAGGCCGTGGGTGATGAGG + Intronic
962535199 3:136322772-136322794 GAGTAGGCTGGTTGGTACTGAGG + Intronic
962557883 3:136573954-136573976 GAGTGAGACGCTGGGTGCAGTGG + Intronic
967109520 3:186281340-186281362 GACTGAGCCTTTTGGTACTGAGG + Intronic
968075545 3:195814202-195814224 GAGTGAGCCTGTAGATGCTGAGG + Intergenic
968135031 3:196214975-196214997 GAGGGAGCCGGGGGGGGCTGCGG - Intronic
968614003 4:1569209-1569231 GGCTGAGCTGGTTGGTCCTGGGG + Intergenic
968830484 4:2931036-2931058 GAGGGCGCGGGATGGTGCTGGGG - Intronic
969490954 4:7498968-7498990 GAGGGAGCCGGCTGAGGCTGGGG + Intronic
969645976 4:8428990-8429012 GATTGAGCTGGTTGCTGCTCTGG - Intronic
972775657 4:42237645-42237667 GAGTGAGGGTGTGGGTGCTGCGG - Intergenic
975670844 4:76779108-76779130 GAGTGAGCCCATTCCTGCTGGGG + Exonic
978416720 4:108484613-108484635 GAGTGAACCGGAAGGGGCTGTGG + Intergenic
983550329 4:169010647-169010669 GCGTGAGCCGGTCGGGGCTCCGG + Intergenic
983649801 4:170026546-170026568 GCGCGAGCCAGTCGGTGCTGCGG + Intronic
983699837 4:170578813-170578835 GAGGGAGCAGGTTTATGCTGAGG - Intergenic
985480587 5:107846-107868 CAGTGATCCGGGTGGGGCTGGGG + Intergenic
985725281 5:1512907-1512929 GTCTGAGCCAGGTGGTGCTGCGG - Intronic
993385878 5:87262531-87262553 AAATGAGCAGGTTGCTGCTGTGG - Intergenic
993969574 5:94401603-94401625 GAGTGAGCCAGTGTGTGTTGAGG - Intronic
997826214 5:137109081-137109103 GAGTGAGCAGGTTTTTGCTGGGG + Intronic
998284933 5:140850222-140850244 CAGTGAGCGAGATGGTGCTGCGG + Exonic
1001117962 5:168955443-168955465 GGCTGAGCCTGTTGGTGGTGAGG - Intronic
1006797808 6:36742322-36742344 GGGCGAGTGGGTTGGTGCTGCGG + Exonic
1007125447 6:39422315-39422337 GAGGGAGCCGCTGAGTGCTGTGG + Intronic
1017963838 6:159246612-159246634 GAGAGAGCTTGGTGGTGCTGAGG + Intronic
1018091256 6:160348312-160348334 GAGTGAGGCGGGTGGCGCGGGGG + Exonic
1018899139 6:168042570-168042592 GAGTGACCGGGTTGGCCCTGAGG + Exonic
1019036288 6:169062599-169062621 CAGTGTGACGGTTGGTGCTGTGG - Intergenic
1019070078 6:169338276-169338298 GAGAGACCAGGATGGTGCTGTGG - Intergenic
1019922702 7:4173072-4173094 CAGGGAGCAGGATGGTGCTGCGG + Intronic
1026018838 7:66693041-66693063 CAGTGAGCCGGCTGGTCCCGTGG + Intronic
1034978890 7:155463353-155463375 GAGGGAGCCGGGTGAGGCTGCGG - Exonic
1035751787 8:2001725-2001747 GAGTGAGCCTGACGGCGCTGCGG + Exonic
1038697896 8:29822251-29822273 GGCTGAGACGGTTGGTGTTGGGG + Intergenic
1039058704 8:33556622-33556644 GAGTGGGCAGGTTGGTGGTCAGG + Intronic
1039525294 8:38209164-38209186 GAGATTGCCGGGTGGTGCTGAGG - Exonic
1041135802 8:54757540-54757562 TAGTGAGCTGGTTACTGCTGTGG + Intergenic
1047676316 8:127207031-127207053 GACTGAGGCCGTTGGTGCTTGGG + Intergenic
1049486967 8:142870510-142870532 GAGTGAGAAGGCTGGAGCTGGGG + Intronic
1049542656 8:143215531-143215553 GGGTGAGCCGGGTGGGGGTGGGG - Intergenic
1049566221 8:143340497-143340519 GGGGGAGCCAGTTGATGCTGGGG - Intronic
1049746494 8:144265390-144265412 GAGGGAGCCCGTGGGTGATGAGG - Intronic
1050401736 9:5263037-5263059 AAGTCAGCCAATTGGTGCTGCGG + Intergenic
1054703309 9:68436051-68436073 GTGTGAGGATGTTGGTGCTGGGG - Intronic
1062462126 9:136666389-136666411 GAGGGAGCCCGTGGGCGCTGGGG + Intronic
1062491087 9:136805198-136805220 GAGGGAGCAGGTTGGGGCGGGGG + Intronic
1186553112 X:10527820-10527842 TAATGAGCAGGTTGTTGCTGTGG - Intronic
1187389609 X:18877349-18877371 GAGAGAGCCGCTAGGTGTTGTGG + Intergenic
1187959384 X:24554094-24554116 GAGTGGGCCACTAGGTGCTGCGG - Intergenic
1197297623 X:124738282-124738304 GACTCAGCTGGTTTGTGCTGAGG + Intronic
1199446696 X:147932073-147932095 GAGTGAGCTGGTTTTTACTGGGG + Intronic
1200182158 X:154157126-154157148 GTGTGAGCAGCTTGCTGCTGAGG - Intronic
1200187812 X:154194240-154194262 GTGTGAGCAGCTTGCTGCTGAGG - Intergenic
1200193462 X:154231380-154231402 GTGTGAGCAGCTTGCTGCTGAGG - Intronic
1200199217 X:154269184-154269206 GTGTGAGCAGCTTGCTGCTGAGG - Intronic