ID: 1090838528

View in Genome Browser
Species Human (GRCh38)
Location 11:130470980-130471002
Sequence CACGGCGAGAGTGAGCCGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090838528_1090838534 0 Left 1090838528 11:130470980-130471002 CCAACCGGCTCACTCTCGCCGTG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1090838534 11:130471003-130471025 GCATGGGTGCCCAAGTACTCCGG 0: 1
1: 0
2: 0
3: 13
4: 126
1090838528_1090838537 13 Left 1090838528 11:130470980-130471002 CCAACCGGCTCACTCTCGCCGTG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1090838537 11:130471016-130471038 AGTACTCCGGCGTGTCTCCCCGG 0: 1
1: 0
2: 0
3: 1
4: 30
1090838528_1090838538 14 Left 1090838528 11:130470980-130471002 CCAACCGGCTCACTCTCGCCGTG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090838528 Original CRISPR CACGGCGAGAGTGAGCCGGT TGG (reversed) Exonic
904684411 1:32250191-32250213 CACTGCCTGAGTGAGCTGGTAGG - Intergenic
916212153 1:162367828-162367850 GACGGGGAGAGTGAGGGGGTAGG - Exonic
920162908 1:204013329-204013351 CACAGCGAGAGTGAGGCAGGAGG + Intergenic
924427932 1:243970853-243970875 CAGGGCGAGAGTAAGCACGTGGG - Intergenic
1070397173 10:76021276-76021298 CACGTCAATAGTGAGCAGGTGGG + Intronic
1077868166 11:6240044-6240066 CCTGGGGAGAGGGAGCCGGTAGG - Exonic
1090838528 11:130470980-130471002 CACGGCGAGAGTGAGCCGGTTGG - Exonic
1127365881 15:58289744-58289766 AAGGTCGAGAGTGAGCCAGTGGG + Intronic
1132749784 16:1452217-1452239 CACGGCGGGAGTGGGCAGGATGG - Intronic
1136554978 16:31002200-31002222 CACTGCGAGGGAGAGCCGGCTGG - Intronic
1145979613 17:29004011-29004033 CAGGGCTAGAGTGAGACTGTGGG - Intronic
1148081514 17:44969619-44969641 CAGGGAGAGTGTGAGCCGGCGGG - Intergenic
1150656903 17:67045199-67045221 CAGGGAGAGAGTGAGCAGGTGGG - Intronic
1152511809 17:80795082-80795104 CACCACGAGAGTGAGCAGGCCGG + Intronic
1152783064 17:82234942-82234964 CAGGGAGAGGCTGAGCCGGTTGG + Exonic
1159076172 18:63684258-63684280 CAGGGAGGGAGTGAGCTGGTGGG + Intronic
926123335 2:10256464-10256486 CAAGGCGCGGGTGACCCGGTGGG + Intergenic
932825132 2:74932212-74932234 CATGGAGAGAGTGAGTGGGTTGG + Intergenic
936015299 2:108954395-108954417 CAGGGCGAGAGAGGGCAGGTAGG - Intronic
945289432 2:208112636-208112658 CACGGCGGGGCTGAGCGGGTGGG + Intergenic
1179323723 21:40318891-40318913 AAAGGCAAGAGTGAGCCAGTGGG + Intronic
1180157415 21:45984232-45984254 CACGGCGGGCGTGAGGCGGGCGG - Intronic
1184381828 22:44149551-44149573 CAAGGTGAGAGTGAGCCGAGTGG - Intronic
984862513 4:184253209-184253231 CACGGCGGGGGTGGGCCGCTCGG - Intergenic
1003566377 6:7226138-7226160 CGAGGCGAGAGCGAGCAGGTCGG + Intronic
1004306386 6:14505462-14505484 GAGGCCCAGAGTGAGCCGGTGGG + Intergenic
1009826928 6:68878995-68879017 CACTGTGAAAGAGAGCCGGTGGG - Intronic
1011488709 6:87869266-87869288 CATGGCGGAAGTGAGCAGGTGGG + Intergenic
1018906022 6:168076440-168076462 TGCTGTGAGAGTGAGCCGGTGGG + Intronic
1021670468 7:23030686-23030708 CATGGGGAGAGGGAGCAGGTGGG - Intergenic
1025824936 7:65003123-65003145 CATGGCTAGAGTGAGCAGGCTGG + Intronic
1033306647 7:140230524-140230546 GGCGGCGAGAGTGCGCCGGGGGG - Intergenic
1034148535 7:148894034-148894056 CAAGGCCAGAGTGAGCTGGGTGG + Intergenic
1060273723 9:122166532-122166554 CAAGGTGAGAGTGAGCCTCTAGG + Intronic
1191050320 X:56184297-56184319 CAAGGCGGGAGTGAGCCTGGGGG + Intergenic
1192368156 X:70492240-70492262 CACGGAGAAAGTGAGCAGATCGG + Exonic
1199525270 X:148784860-148784882 CATGGAGACAGTGAGCCGTTTGG - Intronic