ID: 1090838530

View in Genome Browser
Species Human (GRCh38)
Location 11:130470984-130471006
Sequence ATGCCACGGCGAGAGTGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090838530_1090838538 10 Left 1090838530 11:130470984-130471006 CCGGCTCACTCTCGCCGTGGCAT 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 22
1090838530_1090838534 -4 Left 1090838530 11:130470984-130471006 CCGGCTCACTCTCGCCGTGGCAT 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1090838534 11:130471003-130471025 GCATGGGTGCCCAAGTACTCCGG 0: 1
1: 0
2: 0
3: 13
4: 126
1090838530_1090838537 9 Left 1090838530 11:130470984-130471006 CCGGCTCACTCTCGCCGTGGCAT 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1090838537 11:130471016-130471038 AGTACTCCGGCGTGTCTCCCCGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090838530 Original CRISPR ATGCCACGGCGAGAGTGAGC CGG (reversed) Exonic
900418067 1:2544065-2544087 ATGCCAGGGCCAGAGCGTGCAGG - Intergenic
901195752 1:7438989-7439011 ACACCAGGGCCAGAGTGAGCAGG + Intronic
901435596 1:9245581-9245603 CTGCCAGGGCTAGGGTGAGCTGG + Intronic
903809330 1:26026167-26026189 GTGTCAAGGCTAGAGTGAGCTGG + Intronic
1063474289 10:6315054-6315076 ATGCCACTTAGAGAGTCAGCTGG - Intergenic
1075096941 10:119478247-119478269 ATGCCCCAGAGAGGGTGAGCAGG + Intergenic
1075410733 10:122226096-122226118 ACGCCACGGCGTTGGTGAGCTGG - Intronic
1077112917 11:869796-869818 AAGCCATGGAGTGAGTGAGCAGG - Exonic
1077402452 11:2365957-2365979 GGGCCACGCCGAGAGGGAGCAGG - Intergenic
1090838530 11:130470984-130471006 ATGCCACGGCGAGAGTGAGCCGG - Exonic
1104856368 12:131904216-131904238 AGGCCACAGCTACAGTGAGCCGG - Intronic
1113148307 13:107233782-107233804 ATGCCACAGCGAGAGCGTGAGGG + Intronic
1114485795 14:23060992-23061014 ATGTGACTGCGAGAGTGAGTCGG - Intronic
1114664623 14:24370242-24370264 CTGCCACGGCGGGACAGAGCTGG - Exonic
1126883830 15:53128677-53128699 ATGCCACGGAGAGAGTTTGAGGG + Intergenic
1128111181 15:65077202-65077224 CTGCGACGGCGAGCGCGAGCTGG + Exonic
1131540189 15:93269236-93269258 AGCACACGGCGAGAGGGAGCAGG + Intergenic
1132237579 15:100233759-100233781 ATGTCAGGGGGAGAGTGTGCCGG + Intronic
1132749786 16:1452221-1452243 GTGCCACGGCGGGAGTGGGCAGG - Intronic
1140663047 16:77206393-77206415 AGGACACAGCGAGAGTGAGAGGG - Intronic
1150905044 17:69327649-69327671 ATGCCGCGGCGGGAGGAAGCGGG - Intergenic
1151122537 17:71808670-71808692 AGGCCACGGTGAGTGTGTGCTGG - Intergenic
1163993792 19:21024171-21024193 CTTCCACAGCTAGAGTGAGCAGG - Intronic
1164304767 19:23996145-23996167 ATGGCAAGGCGAGAGCGATCTGG + Intergenic
1164483269 19:28632703-28632725 AGGCCAGGGAGAGAGTGAGGAGG + Intergenic
928269448 2:29843058-29843080 ATGGCAGGGGCAGAGTGAGCAGG + Intronic
934765161 2:96876415-96876437 ATGCCAGGGGCCGAGTGAGCAGG + Intronic
935132942 2:100274943-100274965 ATACCACGGGCACAGTGAGCAGG + Exonic
937023849 2:118681442-118681464 TTGCCCCGGCGGGAGTGTGCTGG + Intergenic
1175053245 20:56174381-56174403 ATGCCATGCCGAGAGTCACCTGG - Intergenic
1175622524 20:60461118-60461140 ATCACACGGTGAGAGGGAGCAGG - Intergenic
1180888408 22:19265940-19265962 ATGTCAAGGCTACAGTGAGCTGG - Intronic
1181959430 22:26612210-26612232 ATGCCAAGGGCAGAGTGAGGGGG + Intronic
1184099118 22:42332448-42332470 GTTCGACGGGGAGAGTGAGCGGG + Intronic
1184423542 22:44395693-44395715 AGGGCACGGGGAGAGAGAGCAGG + Intergenic
949952081 3:9237720-9237742 ATGACAAGGGGAGAGTGACCAGG + Intronic
953020206 3:39108141-39108163 AGGCGCAGGCGAGAGTGAGCTGG - Exonic
954107544 3:48417531-48417553 ATGCCTGGGGAAGAGTGAGCTGG + Intronic
961450644 3:127000897-127000919 ATGGCATGGCCAGTGTGAGCGGG - Intronic
986742437 5:10715717-10715739 ATGCCACGGAGAGAAAGGGCAGG + Intronic
995543232 5:113204605-113204627 ATGCCAGGCAGAGAGCGAGCAGG + Intronic
998159591 5:139805943-139805965 CTGCCACAGGGAGAGTGAGGAGG + Intronic
1007679085 6:43621988-43622010 ATGCCAAGGTGAGAGGGACCTGG - Exonic
1011077362 6:83451239-83451261 ATCTCAAGGCAAGAGTGAGCTGG - Intergenic
1016312068 6:142744812-142744834 ATCCCACAGCAAGAGAGAGCAGG - Intergenic
1025824934 7:65003119-65003141 CTTCCATGGCTAGAGTGAGCAGG + Intronic
1032054237 7:128672023-128672045 ATGCCAAGGCAGCAGTGAGCTGG - Intergenic
1034148531 7:148894030-148894052 CTCCCAAGGCCAGAGTGAGCTGG + Intergenic
1038084003 8:24173652-24173674 AGGCCACGCAGAGAGTGAGGAGG + Intergenic
1038417380 8:27407012-27407034 ATGCCACGCTGAGATTGAGGAGG - Intronic
1040803566 8:51369984-51370006 ATGGCACAGAGACAGTGAGCAGG - Intronic
1045736801 8:105305805-105305827 ATGCCACGCTTAGAATGAGCAGG + Intronic
1047568257 8:126070115-126070137 AGCCCAGGGCTAGAGTGAGCAGG + Intergenic
1048734923 8:137488453-137488475 ATGCCATGGCGAAGGTAAGCAGG + Intergenic
1049255861 8:141613464-141613486 AGGCCATGGGGAGAGTGGGCTGG + Intergenic
1060185762 9:121563147-121563169 AAGCCGGGGTGAGAGTGAGCTGG - Intergenic
1061676877 9:132222412-132222434 ATGCCAGGGAAAGAGTGAACAGG + Intronic
1185497851 X:571274-571296 AAGACACGGTGAGAATGAGCTGG + Intergenic
1188870674 X:35367264-35367286 TTGCCATGGCGACAGTAAGCAGG - Intergenic
1189300458 X:39948662-39948684 ATGCCACTGCGGAAGTGACCAGG + Intergenic
1196815286 X:119660790-119660812 AAGCCAAGGCGGGGGTGAGCGGG + Intronic
1200078723 X:153565111-153565133 GTGCCAGGGCGAGAGCGAGTCGG - Intronic