ID: 1090838533

View in Genome Browser
Species Human (GRCh38)
Location 11:130470998-130471020
Sequence GTACTTGGGCACCCATGCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 4, 3: 5, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090838533_1090838538 -4 Left 1090838533 11:130470998-130471020 CCGTGGCATGGGTGCCCAAGTAC 0: 1
1: 0
2: 4
3: 5
4: 89
Right 1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 22
1090838533_1090838543 27 Left 1090838533 11:130470998-130471020 CCGTGGCATGGGTGCCCAAGTAC 0: 1
1: 0
2: 4
3: 5
4: 89
Right 1090838543 11:130471048-130471070 AAGCTCATCTGCCGAGCCAATGG 0: 1
1: 1
2: 0
3: 5
4: 78
1090838533_1090838537 -5 Left 1090838533 11:130470998-130471020 CCGTGGCATGGGTGCCCAAGTAC 0: 1
1: 0
2: 4
3: 5
4: 89
Right 1090838537 11:130471016-130471038 AGTACTCCGGCGTGTCTCCCCGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090838533 Original CRISPR GTACTTGGGCACCCATGCCA CGG (reversed) Exonic
900645939 1:3708788-3708810 CTGCCTGGGCACCCAGGCCATGG + Intronic
901016856 1:6236690-6236712 GCACCTGGGCATCCATGCAACGG + Intergenic
902696821 1:18145803-18145825 GCCCTTGGGCTCCCCTGCCAAGG + Intronic
904630488 1:31838308-31838330 GTACTGGGGTCCCCATGACACGG - Intergenic
905799504 1:40834265-40834287 CCACTTGGTCACCCAAGCCATGG + Intronic
906592558 1:47040222-47040244 CTCCTTGAGCTCCCATGCCAGGG - Intronic
911903526 1:103535410-103535432 GAACTTAGGCACGCTTGCCAAGG - Exonic
919165231 1:193884515-193884537 GAACTTGGGCAACGGTGCCATGG - Intergenic
919528178 1:198680033-198680055 GTTCTTGCACAGCCATGCCAGGG - Intronic
923707909 1:236360209-236360231 GTACTTGGGAAGCCAAGGCAAGG + Intronic
1066157271 10:32691411-32691433 GTAATTTGGCACCCATTCCTGGG - Intronic
1069638003 10:69937357-69937379 GCAGTTGGGCACCTGTGCCAAGG + Intronic
1070724217 10:78777456-78777478 GTGCCTGGGCACCCATGCCAGGG - Intergenic
1072480733 10:95808644-95808666 GTACTTGAGTCCACATGCCAAGG + Intronic
1073812706 10:107168048-107168070 GTACTTGGTCAGCCATGGTAAGG - Intergenic
1076358320 10:129868842-129868864 GTACATGGGCTCCCATGCAAAGG + Intronic
1076695548 10:132245731-132245753 GGACGTGGGCACTCCTGCCACGG - Intronic
1078581282 11:12541461-12541483 GTCCTTGGGTGCCCATGCAAGGG - Intergenic
1082729184 11:56774260-56774282 GAGAGTGGGCACCCATGCCAGGG - Intergenic
1090838533 11:130470998-130471020 GTACTTGGGCACCCATGCCACGG - Exonic
1091650242 12:2304079-2304101 ATACTTGGGCTCCCTTGCCCGGG + Intronic
1092257663 12:6936218-6936240 GTGGTTGGGCCCCCAGGCCAGGG - Exonic
1093157512 12:15704891-15704913 GTGCATGCGCACGCATGCCAAGG - Intronic
1093207385 12:16267320-16267342 ATACTTGGGCACCGATTTCATGG + Intronic
1098777149 12:74634922-74634944 GTTCTTGCCCACACATGCCAGGG + Intergenic
1099401714 12:82209637-82209659 GATCATGGGCACCCCTGCCAGGG + Intergenic
1104819497 12:131666691-131666713 GGACTTGGCCACCCAGGCCCTGG - Intergenic
1108009419 13:45989327-45989349 GTACTTTGGCACCAAAGCCTGGG - Intronic
1111125438 13:83907511-83907533 GCCCTTGGGCTCCCCTGCCAGGG - Intergenic
1111646019 13:91032799-91032821 GTACATGAGAACCCCTGCCAAGG - Intergenic
1112183393 13:97106474-97106496 GTAGCTGGACCCCCATGCCAAGG + Intergenic
1114192666 14:20452126-20452148 CCAGTGGGGCACCCATGCCAGGG + Exonic
1114933660 14:27506834-27506856 TTACTTGGGCACACATGCACTGG + Intergenic
1115145203 14:30218310-30218332 GTAATTGGGCCCCTATGCAAGGG + Intergenic
1118486202 14:66216325-66216347 GGTCATGGGCACCCTTGCCAGGG + Intergenic
1119610623 14:76058858-76058880 GGACATGGGCATCAATGCCAGGG - Intronic
1127575949 15:60292477-60292499 GTATTTGGGGACCCATACAAAGG + Intergenic
1130055633 15:80523101-80523123 GGACATGAGCATCCATGCCAGGG - Intronic
1136010830 16:27362682-27362704 GCACTTGGGAACTCATCCCAGGG - Exonic
1143409081 17:6697684-6697706 GTTCTTTGGGACCCCTGCCAGGG - Intronic
1145996295 17:29106748-29106770 GCACCTGGGCCCCCATGTCAGGG - Intronic
1148775861 17:50095470-50095492 GTACTTGGGCGCCCCTGCCAGGG - Exonic
1149348579 17:55764467-55764489 CTACTGGGGCATCCATGGCATGG + Intronic
1151652542 17:75479015-75479037 GTACCTGGGCACCAATGGCAGGG - Intronic
1159496331 18:69211944-69211966 GTATCTGGGCACCCATGTTATGG + Intergenic
1161300036 19:3538076-3538098 GGACTTGGGCACCTACGCCGAGG + Intronic
1162804721 19:13131393-13131415 GTACTGGGGCCCACATGACAAGG - Intronic
1163111364 19:15162602-15162624 GTCCTGGGGCCCCCATGTCAGGG + Intronic
1166569378 19:43784193-43784215 GAACTGGGGCACAGATGCCATGG - Intergenic
931110849 2:59109941-59109963 GCAAAAGGGCACCCATGCCATGG - Intergenic
934081064 2:88468124-88468146 GTACTGCGGCAGCCATGCCAGGG + Intergenic
939863198 2:147443280-147443302 GTACTTGAGTATCCTTGCCAAGG - Intergenic
946313863 2:218897212-218897234 CTCCTTGCGCACCCTTGCCATGG - Intronic
948885135 2:240878534-240878556 GCCCTTGAGCACCCAGGCCAGGG - Intronic
1169198923 20:3698147-3698169 GAACATGGGCACTCATCCCACGG + Intronic
1170499037 20:16955839-16955861 TTATTTGGGCATCCATGGCAGGG + Intergenic
1173404462 20:42752855-42752877 GTCCCTGGGCACCCACTCCAGGG + Intronic
1181177755 22:21047480-21047502 GTACCTGGGGCCCCAGGCCACGG - Exonic
1181853808 22:25768574-25768596 GGTCTTGGGGACCCAGGCCAAGG + Exonic
1184644590 22:45889169-45889191 CTCCTTGGCCACCTATGCCAGGG + Intergenic
1184857285 22:47153406-47153428 GTACTTGGCAGCCCCTGCCATGG + Intronic
1185226504 22:49656660-49656682 ATCCTTGGGCGCCCATGTCAGGG + Exonic
951334662 3:21406284-21406306 GCCCTTGGGCACCCCTGCCTGGG + Intergenic
959018101 3:101158811-101158833 GGACTTGGGGACCCATCCAAAGG - Intergenic
959199490 3:103227366-103227388 GTAATTGGGTACCCATGCCATGG + Intergenic
962076393 3:132086752-132086774 TTACTCTGTCACCCATGCCAGGG + Intronic
962144863 3:132830164-132830186 CCATTTGGCCACCCATGCCATGG + Intergenic
968656619 4:1781086-1781108 GAACATGGGCACAGATGCCAAGG + Intergenic
968726724 4:2251310-2251332 GCACTGGGGCACCCAGGCCTGGG + Intronic
974463942 4:62229221-62229243 GTGTGTGTGCACCCATGCCATGG - Intergenic
981042882 4:140239040-140239062 GAGCTTGGGCAGTCATGCCATGG + Intergenic
983095565 4:163557461-163557483 GTCTTTGGGAGCCCATGCCAAGG + Intronic
984480437 4:180294220-180294242 ATCCTTGGGCACCCGGGCCAAGG - Intergenic
985575732 5:672638-672660 GTCCTGAGGCACCCATGGCATGG + Intronic
993273388 5:85824178-85824200 GTACTGGAGAACCCAGGCCACGG - Intergenic
997069515 5:130604011-130604033 GTACTTAGGAACACTTGCCATGG + Intergenic
1003007828 6:2398115-2398137 GCAAAGGGGCACCCATGCCATGG + Intergenic
1015453418 6:133397126-133397148 GTATCTGGGCAGCCATGCCATGG - Intronic
1018908015 6:168086417-168086439 GGACATGGGCATCCATGCTAGGG - Intergenic
1022185334 7:27961804-27961826 GAAATTGTACACCCATGCCATGG + Intronic
1023503611 7:40876786-40876808 GTATTTGTGCATCCATCCCAGGG + Intergenic
1023806851 7:43878547-43878569 CAACTTGGGCACCAATGCCCGGG - Exonic
1024113552 7:46171416-46171438 GAAGGTGGGCCCCCATGCCAAGG + Intergenic
1026074773 7:67156442-67156464 GTACATTGGCAGCCCTGCCAGGG + Intronic
1028280375 7:88918731-88918753 GGCCTTGGACACCGATGCCAGGG - Intronic
1029327621 7:99823438-99823460 GTCCTTGGGCAGCCATGGAAGGG - Intergenic
1034564103 7:151899697-151899719 GTACTGGGGCAACTCTGCCATGG - Intergenic
1039079681 8:33722511-33722533 GCCCTTGGGCACCCCTGCCAGGG - Intergenic
1041991262 8:63994762-63994784 GGACTTTGTCAGCCATGCCAAGG + Intergenic
1042894496 8:73651561-73651583 GCCCTTGGGCACCCCTGCCTGGG + Intronic
1049453016 8:142672520-142672542 GGACTGGGGCTCCCATGGCAGGG + Intronic
1057115049 9:92513100-92513122 GTAATGAGGCCCCCATGCCACGG - Intronic
1057146698 9:92763886-92763908 GTACTGGGGGACCCATGCCAGGG + Intronic
1059703426 9:116797798-116797820 GTACAGGAGCACCAATGCCAAGG - Intronic
1061304832 9:129726162-129726184 CTTCCTGGGCACCCATCCCAGGG + Intergenic
1187407385 X:19016064-19016086 GTACCTCGGCACCGATGCCTGGG + Intronic
1189418046 X:40832033-40832055 GTACTTGGCCACCGATGCAGTGG - Intergenic
1194469299 X:94272675-94272697 CTCCTTGGCCACCCAAGCCATGG + Intergenic
1195878674 X:109569959-109569981 GTCCTGGACCACCCATGCCAAGG + Intergenic