ID: 1090838538

View in Genome Browser
Species Human (GRCh38)
Location 11:130471017-130471039
Sequence GTACTCCGGCGTGTCTCCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 22}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090838527_1090838538 22 Left 1090838527 11:130470972-130470994 CCACAGCACCAACCGGCTCACTC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 22
1090838533_1090838538 -4 Left 1090838533 11:130470998-130471020 CCGTGGCATGGGTGCCCAAGTAC 0: 1
1: 0
2: 4
3: 5
4: 89
Right 1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 22
1090838530_1090838538 10 Left 1090838530 11:130470984-130471006 CCGGCTCACTCTCGCCGTGGCAT 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 22
1090838528_1090838538 14 Left 1090838528 11:130470980-130471002 CCAACCGGCTCACTCTCGCCGTG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090838538 Original CRISPR GTACTCCGGCGTGTCTCCCC GGG Exonic
1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG + Exonic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1106197491 13:27506884-27506906 GTACTCCTGAGTGTGTACCCAGG + Intergenic
1120979921 14:90280354-90280376 GGACTCCTGCGTGTCCTCCCTGG + Intronic
1139465481 16:67151689-67151711 GCACTTCAGCCTGTCTCCCCGGG + Intergenic
1147456237 17:40539981-40540003 GTACTTTGGCTTGTGTCCCCTGG - Intergenic
1151801253 17:76381274-76381296 GTTCTCAGGTGTGTCTCCCTGGG + Intronic
1152794211 17:82298891-82298913 GACCTCCGGCTTGTCACCCCAGG - Intergenic
1161123070 19:2540737-2540759 TTGCTCCGGCAGGTCTCCCCGGG - Intronic
1167603799 19:50469317-50469339 GTTCTCAGGGATGTCTCCCCTGG + Intronic
925486349 2:4336265-4336287 TGACACCAGCGTGTCTCCCCTGG - Intergenic
925893579 2:8455257-8455279 GGACTCCGGCGGGCCTTCCCTGG - Intergenic
950896313 3:16454785-16454807 GTTTTCTGGCGTGTCTCCCAGGG + Intronic
951069609 3:18311704-18311726 GTACTCTGTCCTGTCTGCCCTGG + Intronic
952023136 3:29047290-29047312 GTACTCCTGCTTGACTACCCAGG + Intergenic
967885976 3:194333759-194333781 GCACTCCGGCAAGTATCCCCCGG + Intergenic
970264575 4:14267235-14267257 GTATTCCGGCCAGTCTCCACTGG - Intergenic
971331045 4:25681620-25681642 ATACTCCTGTCTGTCTCCCCAGG + Intergenic
987011874 5:13774523-13774545 GTACTCCAGAGTCTCTCCCCAGG - Intronic
1012625485 6:101399686-101399708 CCACTCCCGCCTGTCTCCCCCGG + Intronic
1019055774 6:169222271-169222293 CTACTCCGGCGTGTCCCTCAAGG - Exonic
1024940542 7:54759058-54759080 GCGAGCCGGCGTGTCTCCCCGGG - Intronic
1050776788 9:9273628-9273650 GTACTCTAGAGTGTCTACCCAGG + Intronic
1192093928 X:68190143-68190165 GTCCTCTGGCGTGTCTCACTGGG - Intronic