ID: 1090839590

View in Genome Browser
Species Human (GRCh38)
Location 11:130476513-130476535
Sequence TGCACTCCATGTACTGCAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 113}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090839584_1090839590 5 Left 1090839584 11:130476485-130476507 CCCTCCCCGCCGTTGTGTTTGGT 0: 1
1: 0
2: 1
3: 1
4: 55
Right 1090839590 11:130476513-130476535 TGCACTCCATGTACTGCAGAAGG 0: 1
1: 0
2: 1
3: 4
4: 113
1090839589_1090839590 -4 Left 1090839589 11:130476494-130476516 CCGTTGTGTTTGGTTCTTTTGCA 0: 1
1: 0
2: 3
3: 35
4: 420
Right 1090839590 11:130476513-130476535 TGCACTCCATGTACTGCAGAAGG 0: 1
1: 0
2: 1
3: 4
4: 113
1090839586_1090839590 1 Left 1090839586 11:130476489-130476511 CCCCGCCGTTGTGTTTGGTTCTT 0: 1
1: 0
2: 1
3: 2
4: 81
Right 1090839590 11:130476513-130476535 TGCACTCCATGTACTGCAGAAGG 0: 1
1: 0
2: 1
3: 4
4: 113
1090839587_1090839590 0 Left 1090839587 11:130476490-130476512 CCCGCCGTTGTGTTTGGTTCTTT 0: 1
1: 0
2: 2
3: 42
4: 449
Right 1090839590 11:130476513-130476535 TGCACTCCATGTACTGCAGAAGG 0: 1
1: 0
2: 1
3: 4
4: 113
1090839581_1090839590 9 Left 1090839581 11:130476481-130476503 CCCTCCCTCCCCGCCGTTGTGTT 0: 1
1: 0
2: 0
3: 8
4: 182
Right 1090839590 11:130476513-130476535 TGCACTCCATGTACTGCAGAAGG 0: 1
1: 0
2: 1
3: 4
4: 113
1090839588_1090839590 -1 Left 1090839588 11:130476491-130476513 CCGCCGTTGTGTTTGGTTCTTTT 0: 1
1: 0
2: 0
3: 13
4: 317
Right 1090839590 11:130476513-130476535 TGCACTCCATGTACTGCAGAAGG 0: 1
1: 0
2: 1
3: 4
4: 113
1090839585_1090839590 4 Left 1090839585 11:130476486-130476508 CCTCCCCGCCGTTGTGTTTGGTT 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1090839590 11:130476513-130476535 TGCACTCCATGTACTGCAGAAGG 0: 1
1: 0
2: 1
3: 4
4: 113
1090839582_1090839590 8 Left 1090839582 11:130476482-130476504 CCTCCCTCCCCGCCGTTGTGTTT 0: 1
1: 0
2: 2
3: 15
4: 234
Right 1090839590 11:130476513-130476535 TGCACTCCATGTACTGCAGAAGG 0: 1
1: 0
2: 1
3: 4
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090839590 Original CRISPR TGCACTCCATGTACTGCAGA AGG Exonic
902417203 1:16247201-16247223 GCCTCTCCATGAACTGCAGAAGG - Exonic
903368717 1:22820625-22820647 TGCACTCCATGCACTCCAGCCGG + Intronic
914377938 1:147089616-147089638 TGCACTCCCTGGAATGCAAAGGG + Intergenic
915076032 1:153308644-153308666 TGCACTCCTTGGAGTGCACATGG + Intronic
916727978 1:167540300-167540322 TGCACCCCACCTGCTGCAGAAGG - Intronic
1063306269 10:4903656-4903678 GGGACACCATGCACTGCAGAAGG - Intergenic
1063453256 10:6165161-6165183 GGGACACCATGCACTGCAGAAGG - Intronic
1067191289 10:44070353-44070375 TCAACTGCATGTACTGCTGATGG + Intergenic
1071017658 10:81017447-81017469 TCCTCTCCTTGTCCTGCAGATGG + Intergenic
1071611787 10:87038554-87038576 TGCCCTGCAAGTACTGCAGCAGG - Intergenic
1077188095 11:1244415-1244437 TGCAGTCCCTGGACTGGAGAAGG - Exonic
1077189050 11:1248186-1248208 TGCAGTCCCTGGACTGGAGAAGG - Exonic
1077402520 11:2366245-2366267 TGCCCTCCAGGCACGGCAGACGG + Intergenic
1079408701 11:20166589-20166611 CTCACTCCCTGTACTTCAGAAGG + Intergenic
1079732785 11:23956715-23956737 TGTACTCCATGTCATGCAGTAGG - Intergenic
1083913127 11:65721371-65721393 TGTAATCCAAGTACTTCAGAAGG - Intergenic
1084030413 11:66477633-66477655 TGCAGCCCATGGTCTGCAGAGGG + Intergenic
1089004736 11:115082000-115082022 TGCACTCCATGCAGGGCAGTTGG - Intergenic
1089629910 11:119778078-119778100 TGCACACCTAGCACTGCAGATGG - Intergenic
1090097086 11:123752883-123752905 TGTAATCCATGAACTGCAAATGG + Intergenic
1090523404 11:127503385-127503407 TTCACTCCATGCACTGGAGCTGG - Intergenic
1090839590 11:130476513-130476535 TGCACTCCATGTACTGCAGAAGG + Exonic
1091410078 12:233437-233459 TGCACTCCCTCTACTACAGCGGG - Intronic
1096493685 12:52026966-52026988 TCAACTCCATGGACCGCAGATGG + Intronic
1099481435 12:83171315-83171337 TGACTTCCATGAACTGCAGATGG - Intergenic
1099588017 12:84546218-84546240 TGCAAGCCTGGTACTGCAGAGGG + Intergenic
1101966941 12:109288027-109288049 GGCACTGCATGGACTGCGGAGGG - Intronic
1103608526 12:122106511-122106533 TCCACTCCCTGGCCTGCAGAGGG + Intronic
1107632254 13:42354591-42354613 GCTACTACATGTACTGCAGAAGG - Intergenic
1113312930 13:109149781-109149803 TGCATCCCTGGTACTGCAGAAGG - Intronic
1113467743 13:110524154-110524176 TGGGCTCCATGTACTGCCGGGGG - Exonic
1116687300 14:48056251-48056273 TGCAGTTGATGTACTGCATATGG + Intergenic
1118628243 14:67678523-67678545 TGTTCTCCATGTACTTCACAGGG + Intronic
1119801947 14:77453389-77453411 TGGACTCCTTTAACTGCAGAGGG + Exonic
1121807833 14:96847451-96847473 TACACTCCACATACTCCAGAGGG - Intronic
1127063998 15:55217862-55217884 TGGTCTCCATGTACTCCAAATGG - Intronic
1131438691 15:92442515-92442537 TGGACTCCATGCAGTTCAGATGG - Intronic
1133111228 16:3549424-3549446 TCCTCTCCCTGTACTGCGGATGG - Intronic
1133616602 16:7482838-7482860 TGAACACCATGTACAGGAGATGG + Intronic
1133997091 16:10756680-10756702 TGTCTTCCACGTACTGCAGAGGG - Exonic
1142867090 17:2797670-2797692 GGCACTCCATGTTTGGCAGATGG + Intronic
1144584415 17:16479447-16479469 TGCAGGGCATGTACTGCACAAGG + Intronic
1150633170 17:66894536-66894558 TGCACATCATGAACTGGAGAGGG - Intergenic
1151592261 17:75053217-75053239 TGCATTCCCTGCACTGCAAACGG - Intronic
1159429793 18:68336891-68336913 TGCACTCCATAAACTGGTGAAGG - Intergenic
1163713503 19:18860931-18860953 TGAACTGCATGTACTGCACCAGG - Exonic
1164411196 19:28007085-28007107 GGCATGCCATGTACTGCACATGG - Intergenic
1165818769 19:38660907-38660929 TGCAGTGCAGGTACTTCAGATGG + Intronic
1165831700 19:38733807-38733829 TGCCCTCCATGCCCTGAAGAGGG + Intronic
1167819024 19:51909272-51909294 GGGACTCAATGCACTGCAGAAGG + Intronic
925346406 2:3175041-3175063 GGAACCCCAGGTACTGCAGAGGG - Intergenic
925871399 2:8274473-8274495 TGCACTTCATGTTCTGGAGACGG + Intergenic
926063706 2:9820816-9820838 TGGATTCAATGAACTGCAGATGG + Intergenic
927050686 2:19325100-19325122 AGCCCTCCCTGGACTGCAGAAGG - Intergenic
929392717 2:41489845-41489867 TGCAATCAAGGTACTGCAGTGGG + Intergenic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
939325938 2:140688549-140688571 TCCACTGCATGGATTGCAGAAGG + Intronic
939689631 2:145241829-145241851 GGGACTCCATCTATTGCAGAGGG - Intergenic
943293166 2:186101827-186101849 TGGAGTCCATGTGCTCCAGATGG + Intergenic
944928501 2:204491353-204491375 AGCACCCCATGGATTGCAGAGGG + Intergenic
1170785149 20:19461221-19461243 TTCACTCCATGTTCTCTAGATGG + Intronic
1176039415 20:63056435-63056457 TGCACTCCCTGCTTTGCAGAGGG + Intergenic
1176141254 20:63546114-63546136 TGCCCTCCAGGAACTGCTGAAGG + Intronic
1176229735 20:64026084-64026106 TGCACACCATGCACCCCAGACGG - Intronic
1177677456 21:24319672-24319694 TGGACTCCATGTACTGTTTATGG + Intergenic
1177696401 21:24578848-24578870 AGCAATCCATAAACTGCAGATGG - Intergenic
1178180239 21:30151948-30151970 TGCACTGCCTGTAATGTAGATGG - Intergenic
1181295003 22:21830725-21830747 TGCACTCCAATTAATACAGAAGG + Intronic
950569196 3:13789531-13789553 TGCCCTCCTTGTTCTACAGATGG - Intergenic
953781110 3:45871838-45871860 TGGCTTCCATGTTCTGCAGAGGG + Intronic
953804354 3:46055050-46055072 TGAACTCAATACACTGCAGAGGG - Intergenic
956452646 3:69389698-69389720 TCCACTCCAGGGACTGCAGTGGG + Intronic
960252774 3:115474732-115474754 TGCACTCCAAGCACTGGAGTTGG - Intergenic
961250390 3:125499300-125499322 TGCCCTCCATGAAATGCACAAGG + Intronic
962625459 3:137221403-137221425 TGCATTCCATGTAATGTACAAGG + Intergenic
962868506 3:139467784-139467806 TGCACTCCATGTTTTGCAAGGGG + Intronic
969572117 4:8015250-8015272 TGCATTCACTGCACTGCAGAAGG + Intronic
969633683 4:8353039-8353061 TGCCCACCTTGCACTGCAGAGGG + Intergenic
969938310 4:10705212-10705234 TTCTCTCCACTTACTGCAGAAGG - Intergenic
970271489 4:14352853-14352875 TGGTCTCCATTTCCTGCAGAAGG - Intergenic
970897590 4:21121240-21121262 TGCACTCCTTTTTCTGCATAAGG - Intronic
971158627 4:24109885-24109907 TGTCCTCCAGCTACTGCAGATGG + Intergenic
971542829 4:27842600-27842622 TGTACTCCATGTGCTGCATATGG + Intergenic
971876741 4:32318266-32318288 TGCACCATATGTACTGCACATGG + Intergenic
975154128 4:71052443-71052465 TGAACTCCATGTCCTCTAGAAGG + Intergenic
978349211 4:107803650-107803672 GGTACTCCAGGTACTACAGAAGG - Intergenic
986007151 5:3677723-3677745 TGCTCCCCATGTGCTGCAGGAGG - Intergenic
992436904 5:76763184-76763206 GGCAGTCCATGAGCTGCAGAGGG - Intergenic
993380195 5:87198197-87198219 TGTACTCCATGTTCTCCATATGG - Intergenic
996064031 5:119062205-119062227 TTCATTCCCTGTACAGCAGAAGG - Intronic
996926103 5:128828470-128828492 TGCACTGCCTGCAGTGCAGAAGG - Intronic
998795308 5:145811986-145812008 TGCAGCCCATGTGCTTCAGAGGG + Intronic
998922061 5:147080676-147080698 TGCACTTCATGTATTGCCAATGG + Intronic
999051197 5:148525534-148525556 AGGACTCAATGTCCTGCAGAGGG + Intronic
1000977184 5:167778043-167778065 TGCACCACATGGACTGCAAAGGG + Intronic
1003170028 6:3713888-3713910 TGCATTCCAAGCACTGCACAAGG - Intergenic
1004049994 6:12067724-12067746 TGCACTCCATGGTCTGGTGAGGG + Intronic
1004328990 6:14704254-14704276 TGCAGTCCATAAACTGCAAAAGG + Intergenic
1007170043 6:39856395-39856417 AGAACTCCATGAACTGCAGAGGG - Exonic
1007407269 6:41642288-41642310 TGCAATTCATGTACTGCAGAAGG - Intronic
1007765319 6:44156387-44156409 TGTACTGCATGTACTGTAGGAGG + Intergenic
1008437807 6:51496680-51496702 TGGACTCCATCCACTTCAGAAGG - Intergenic
1008794766 6:55289565-55289587 TGCACTCCTGATACTCCAGATGG + Intergenic
1009903996 6:69845754-69845776 TTCACTCCATGTAATTCAGTTGG - Intergenic
1018910252 6:168097555-168097577 TGGGCTCCATGTTCTGGAGAGGG - Intergenic
1020040089 7:4995382-4995404 TGCACTGCATGTATGGCAGGGGG + Intronic
1022815396 7:33908958-33908980 TGAAATCCATGAACTGCAGTGGG - Intronic
1025901579 7:65749346-65749368 TGCACACCATGTAATGCCTATGG + Intergenic
1026542158 7:71289047-71289069 TGCAACCCCTGTACTGCTGAAGG - Intronic
1036490474 8:9220666-9220688 TGCTCTCCAGATACAGCAGAGGG - Intergenic
1038400031 8:27277653-27277675 TTCCTTCCAGGTACTGCAGATGG + Intergenic
1044380805 8:91530953-91530975 TGCAGTCATTGTACAGCAGAGGG + Intergenic
1046691253 8:117287546-117287568 TTCAGTCCATGTAGTTCAGATGG + Intergenic
1048276251 8:133068216-133068238 AGCACTCCATGCCCTGCAGGAGG + Intronic
1051689781 9:19698753-19698775 TTCACTCTCTGTATTGCAGAAGG + Intronic
1054730756 9:68700774-68700796 GGCACTAAATGTATTGCAGAAGG + Intergenic
1055599443 9:77900561-77900583 TACACTCCATGCAGTGGAGATGG + Intronic
1056725613 9:89112614-89112636 TGCACCCCAAGTACTGCAAGGGG + Exonic
1185816430 X:3160322-3160344 TGCACTCTTTGTACCTCAGAAGG + Intergenic