ID: 1090845269

View in Genome Browser
Species Human (GRCh38)
Location 11:130524953-130524975
Sequence GACGGTTGTATTAACTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090845269_1090845273 20 Left 1090845269 11:130524953-130524975 CCTGTGCAGTTAATACAACCGTC No data
Right 1090845273 11:130524996-130525018 CTCACTGCCCAGAGAGGACACGG No data
1090845269_1090845271 14 Left 1090845269 11:130524953-130524975 CCTGTGCAGTTAATACAACCGTC No data
Right 1090845271 11:130524990-130525012 TACCTGCTCACTGCCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090845269 Original CRISPR GACGGTTGTATTAACTGCAC AGG (reversed) Intergenic
No off target data available for this crispr