ID: 1090845270

View in Genome Browser
Species Human (GRCh38)
Location 11:130524971-130524993
Sequence GGTAACTGAGAAAATTGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090845270_1090845277 25 Left 1090845270 11:130524971-130524993 CCGTCACAATTTTCTCAGTTACC No data
Right 1090845277 11:130525019-130525041 TAAGTGTCACCTGGACTTCTTGG No data
1090845270_1090845276 16 Left 1090845270 11:130524971-130524993 CCGTCACAATTTTCTCAGTTACC No data
Right 1090845276 11:130525010-130525032 AGGACACGGTAAGTGTCACCTGG No data
1090845270_1090845273 2 Left 1090845270 11:130524971-130524993 CCGTCACAATTTTCTCAGTTACC No data
Right 1090845273 11:130524996-130525018 CTCACTGCCCAGAGAGGACACGG No data
1090845270_1090845271 -4 Left 1090845270 11:130524971-130524993 CCGTCACAATTTTCTCAGTTACC No data
Right 1090845271 11:130524990-130525012 TACCTGCTCACTGCCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090845270 Original CRISPR GGTAACTGAGAAAATTGTGA CGG (reversed) Intergenic
No off target data available for this crispr