ID: 1090845273

View in Genome Browser
Species Human (GRCh38)
Location 11:130524996-130525018
Sequence CTCACTGCCCAGAGAGGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090845270_1090845273 2 Left 1090845270 11:130524971-130524993 CCGTCACAATTTTCTCAGTTACC No data
Right 1090845273 11:130524996-130525018 CTCACTGCCCAGAGAGGACACGG No data
1090845268_1090845273 29 Left 1090845268 11:130524944-130524966 CCTACGTGGCCTGTGCAGTTAAT No data
Right 1090845273 11:130524996-130525018 CTCACTGCCCAGAGAGGACACGG No data
1090845269_1090845273 20 Left 1090845269 11:130524953-130524975 CCTGTGCAGTTAATACAACCGTC No data
Right 1090845273 11:130524996-130525018 CTCACTGCCCAGAGAGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090845273 Original CRISPR CTCACTGCCCAGAGAGGACA CGG Intergenic
No off target data available for this crispr