ID: 1090848038

View in Genome Browser
Species Human (GRCh38)
Location 11:130546710-130546732
Sequence CCTTCCCCACTCCCTTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090848038_1090848045 5 Left 1090848038 11:130546710-130546732 CCCCTGCAAGGGAGTGGGGAAGG No data
Right 1090848045 11:130546738-130546760 ACTTGGCTTAAGTCCAGGCAGGG No data
1090848038_1090848047 16 Left 1090848038 11:130546710-130546732 CCCCTGCAAGGGAGTGGGGAAGG No data
Right 1090848047 11:130546749-130546771 GTCCAGGCAGGGGTCACAGCTGG No data
1090848038_1090848048 17 Left 1090848038 11:130546710-130546732 CCCCTGCAAGGGAGTGGGGAAGG No data
Right 1090848048 11:130546750-130546772 TCCAGGCAGGGGTCACAGCTGGG No data
1090848038_1090848050 27 Left 1090848038 11:130546710-130546732 CCCCTGCAAGGGAGTGGGGAAGG No data
Right 1090848050 11:130546760-130546782 GGTCACAGCTGGGACCCCAAAGG No data
1090848038_1090848044 4 Left 1090848038 11:130546710-130546732 CCCCTGCAAGGGAGTGGGGAAGG No data
Right 1090848044 11:130546737-130546759 GACTTGGCTTAAGTCCAGGCAGG No data
1090848038_1090848046 6 Left 1090848038 11:130546710-130546732 CCCCTGCAAGGGAGTGGGGAAGG No data
Right 1090848046 11:130546739-130546761 CTTGGCTTAAGTCCAGGCAGGGG No data
1090848038_1090848043 0 Left 1090848038 11:130546710-130546732 CCCCTGCAAGGGAGTGGGGAAGG No data
Right 1090848043 11:130546733-130546755 CAAAGACTTGGCTTAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090848038 Original CRISPR CCTTCCCCACTCCCTTGCAG GGG (reversed) Intergenic
No off target data available for this crispr