ID: 1090848743

View in Genome Browser
Species Human (GRCh38)
Location 11:130552194-130552216
Sequence CTCACATAGTGGACGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090848743_1090848748 6 Left 1090848743 11:130552194-130552216 CCTTGTCCCGTCCACTATGTGAG No data
Right 1090848748 11:130552223-130552245 GCTAGAAGGTGCCACCCATGAGG No data
1090848743_1090848747 -8 Left 1090848743 11:130552194-130552216 CCTTGTCCCGTCCACTATGTGAG No data
Right 1090848747 11:130552209-130552231 TATGTGAGAATATAGCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090848743 Original CRISPR CTCACATAGTGGACGGGACA AGG (reversed) Intergenic
No off target data available for this crispr