ID: 1090850043

View in Genome Browser
Species Human (GRCh38)
Location 11:130564032-130564054
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090850037_1090850043 -8 Left 1090850037 11:130564017-130564039 CCAAGACCTGACTCTGAGTATAA No data
Right 1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG No data
1090850031_1090850043 14 Left 1090850031 11:130563995-130564017 CCGCAGGCCAGTCCCTCCAAACC No data
Right 1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG No data
1090850032_1090850043 7 Left 1090850032 11:130564002-130564024 CCAGTCCCTCCAAACCCAAGACC No data
Right 1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG No data
1090850035_1090850043 -2 Left 1090850035 11:130564011-130564033 CCAAACCCAAGACCTGACTCTGA No data
Right 1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG No data
1090850030_1090850043 15 Left 1090850030 11:130563994-130564016 CCCGCAGGCCAGTCCCTCCAAAC No data
Right 1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG No data
1090850034_1090850043 1 Left 1090850034 11:130564008-130564030 CCTCCAAACCCAAGACCTGACTC No data
Right 1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG No data
1090850036_1090850043 -7 Left 1090850036 11:130564016-130564038 CCCAAGACCTGACTCTGAGTATA No data
Right 1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG No data
1090850027_1090850043 25 Left 1090850027 11:130563984-130564006 CCCAGACAACCCCGCAGGCCAGT No data
Right 1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG No data
1090850029_1090850043 16 Left 1090850029 11:130563993-130564015 CCCCGCAGGCCAGTCCCTCCAAA No data
Right 1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG No data
1090850033_1090850043 2 Left 1090850033 11:130564007-130564029 CCCTCCAAACCCAAGACCTGACT No data
Right 1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG No data
1090850028_1090850043 24 Left 1090850028 11:130563985-130564007 CCAGACAACCCCGCAGGCCAGTC No data
Right 1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090850043 Original CRISPR GAGTATAAGGAGAGGGAAGA GGG Intergenic
No off target data available for this crispr