ID: 1090851056

View in Genome Browser
Species Human (GRCh38)
Location 11:130570916-130570938
Sequence CAGGGTCACCATTCTGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090851050_1090851056 -8 Left 1090851050 11:130570901-130570923 CCTTGCCCAGCTCTCCAGGGTCA No data
Right 1090851056 11:130570916-130570938 CAGGGTCACCATTCTGAGGGCGG No data
1090851046_1090851056 21 Left 1090851046 11:130570872-130570894 CCATTAGCAGTCAGCCTCTGAGA No data
Right 1090851056 11:130570916-130570938 CAGGGTCACCATTCTGAGGGCGG No data
1090851047_1090851056 7 Left 1090851047 11:130570886-130570908 CCTCTGAGAGAGCTGCCTTGCCC No data
Right 1090851056 11:130570916-130570938 CAGGGTCACCATTCTGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090851056 Original CRISPR CAGGGTCACCATTCTGAGGG CGG Intergenic
No off target data available for this crispr