ID: 1090855569

View in Genome Browser
Species Human (GRCh38)
Location 11:130607280-130607302
Sequence CTTGAGGCTCCCCCATTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090855567_1090855569 2 Left 1090855567 11:130607255-130607277 CCTTTTGCACTTTCAACAAGCTT No data
Right 1090855569 11:130607280-130607302 CTTGAGGCTCCCCCATTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090855569 Original CRISPR CTTGAGGCTCCCCCATTGCT AGG Intergenic
No off target data available for this crispr