ID: 1090858715

View in Genome Browser
Species Human (GRCh38)
Location 11:130634236-130634258
Sequence GAATCCTCTGGGCATCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090858710_1090858715 9 Left 1090858710 11:130634204-130634226 CCTCAAAGGTGGGAGACGCTGAT No data
Right 1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG No data
1090858705_1090858715 26 Left 1090858705 11:130634187-130634209 CCCACTTCTTGAAGTTTCCTCAA No data
Right 1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG No data
1090858706_1090858715 25 Left 1090858706 11:130634188-130634210 CCACTTCTTGAAGTTTCCTCAAA No data
Right 1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090858715 Original CRISPR GAATCCTCTGGGCATCCCTG TGG Intergenic
No off target data available for this crispr