ID: 1090863387

View in Genome Browser
Species Human (GRCh38)
Location 11:130673836-130673858
Sequence AAGGCCTGCTCTCCTTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 324}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090863379_1090863387 29 Left 1090863379 11:130673784-130673806 CCTTCTTGGTCCTTGAAGGTAGC 0: 1
1: 0
2: 0
3: 13
4: 125
Right 1090863387 11:130673836-130673858 AAGGCCTGCTCTCCTTCCTCTGG 0: 1
1: 0
2: 1
3: 39
4: 324
1090863382_1090863387 4 Left 1090863382 11:130673809-130673831 CCAACACCTGTTTCCATGCTCTA 0: 1
1: 0
2: 0
3: 14
4: 187
Right 1090863387 11:130673836-130673858 AAGGCCTGCTCTCCTTCCTCTGG 0: 1
1: 0
2: 1
3: 39
4: 324
1090863383_1090863387 -2 Left 1090863383 11:130673815-130673837 CCTGTTTCCATGCTCTAGTCCAA 0: 1
1: 0
2: 1
3: 7
4: 159
Right 1090863387 11:130673836-130673858 AAGGCCTGCTCTCCTTCCTCTGG 0: 1
1: 0
2: 1
3: 39
4: 324
1090863381_1090863387 5 Left 1090863381 11:130673808-130673830 CCCAACACCTGTTTCCATGCTCT 0: 1
1: 0
2: 0
3: 21
4: 276
Right 1090863387 11:130673836-130673858 AAGGCCTGCTCTCCTTCCTCTGG 0: 1
1: 0
2: 1
3: 39
4: 324
1090863385_1090863387 -9 Left 1090863385 11:130673822-130673844 CCATGCTCTAGTCCAAGGCCTGC 0: 1
1: 0
2: 3
3: 19
4: 214
Right 1090863387 11:130673836-130673858 AAGGCCTGCTCTCCTTCCTCTGG 0: 1
1: 0
2: 1
3: 39
4: 324
1090863380_1090863387 19 Left 1090863380 11:130673794-130673816 CCTTGAAGGTAGCACCCAACACC 0: 1
1: 0
2: 0
3: 16
4: 104
Right 1090863387 11:130673836-130673858 AAGGCCTGCTCTCCTTCCTCTGG 0: 1
1: 0
2: 1
3: 39
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090863387 Original CRISPR AAGGCCTGCTCTCCTTCCTC TGG Intronic
900718723 1:4161440-4161462 CGGGCTTGCTCTACTTCCTCTGG - Intergenic
901952301 1:12758720-12758742 AAGCCATGTTCTCCTTACTCTGG - Intronic
902110276 1:14072602-14072624 AAGCCCTGGTATCCTTCCACTGG + Intergenic
902697070 1:18147256-18147278 ATGCCTTACTCTCCTTCCTCTGG + Intronic
903185579 1:21627056-21627078 CAGACCTGCTTTCTTTCCTCAGG - Intronic
903281142 1:22250715-22250737 AAAGCCTGTGCTCCTTCTTCTGG + Intergenic
904475479 1:30762142-30762164 AAGGCCTGGGCCCCTTCCACAGG - Intergenic
904689269 1:32281730-32281752 AAGGTCTGTTCACCTTGCTCTGG - Intronic
904922463 1:34019747-34019769 AAGGCCCGAACTCCTTCCTGTGG + Intronic
906614074 1:47223252-47223274 AGTGCCTGCTCTCCTACCCCTGG + Intronic
907271183 1:53292122-53292144 CAGGCCTGCTCCCCCTCCTCTGG + Intronic
907727730 1:57035459-57035481 AAGGCCACCTCTCCTTTCCCAGG - Intronic
909992368 1:82239456-82239478 ATGGCATTCTATCCTTCCTCTGG + Intergenic
910211071 1:84794051-84794073 CAGGCCTGCTCACTCTCCTCAGG - Intergenic
911720320 1:101183611-101183633 AAGACCTGTCCTCCTGCCTCTGG + Intergenic
912437017 1:109668864-109668886 AAGCCCAGCCCTCCTTCCTGGGG - Intronic
915595779 1:156895659-156895681 TAGGCCTGCTTTTCTCCCTCCGG - Intronic
915634103 1:157174368-157174390 CAGCCCTGCCCTCCTCCCTCGGG - Intergenic
915698270 1:157766971-157766993 AAGCACTGCTTTCTTTCCTCAGG - Exonic
915835657 1:159172953-159172975 ACAGCCTGCCCTCCCTCCTCAGG - Intronic
916282930 1:163072494-163072516 AAGGCCTTTTCTCTTACCTCTGG - Exonic
917740974 1:177961897-177961919 AAGGCCTGCACTCTTTCCATTGG - Intronic
917963789 1:180166068-180166090 AAGGCATGTTCTCCACCCTCTGG + Intronic
918247680 1:182674210-182674232 CAGCCCTGCTCTCTTTCCTTGGG - Intronic
922209692 1:223478151-223478173 ATGCCCTGCCCTCCTTCCTGGGG + Intergenic
922779416 1:228239958-228239980 ATGGCCTCCTCTCCACCCTCGGG - Intronic
922909317 1:229202367-229202389 AAGGCCCTCTCTCCTTCCTGGGG - Intergenic
923463716 1:234230607-234230629 AACGCCTTTTCACCTTCCTCTGG + Intronic
923928436 1:238663310-238663332 AGGTCCTGCTCTTCTTACTCCGG - Intergenic
923973228 1:239228977-239228999 AAGGCTTGCTAACCATCCTCAGG + Intergenic
1064192520 10:13220073-13220095 AAGCCCTGCATTCCTTCCTGTGG + Intergenic
1064546886 10:16459772-16459794 AAGTTTTGCTCTCCTTACTCAGG + Intronic
1064584741 10:16828821-16828843 AACGCCAGCTCTCCATCCTCTGG - Exonic
1067145737 10:43692488-43692510 TGGGTATGCTCTCCTTCCTCAGG + Intergenic
1067663856 10:48256690-48256712 AAGGCCTCCTCTGCTTCCCTTGG - Intronic
1067713839 10:48671822-48671844 AAGGCCTGCCTCCCTTCCTCTGG - Intergenic
1067756762 10:49011480-49011502 AAGGCCTGCACTGCTACCTGGGG + Intergenic
1068606170 10:59007657-59007679 AAGTCCATCTCTCCTTCTTCTGG + Intergenic
1070391607 10:75975604-75975626 ATGGCATGCTCTCCTTTCTTTGG + Intronic
1071349247 10:84722974-84722996 AAGTTTTGCTCTCCTTCCTCTGG - Intergenic
1076257844 10:129042532-129042554 ACGGCCGGGTCTCCTTCCTCAGG + Intergenic
1076274306 10:129183586-129183608 AAGCACTGCACTTCTTCCTCTGG + Intergenic
1077404339 11:2376447-2376469 AAGGCCTTCGCTCCTTCCTCTGG + Intronic
1077606764 11:3617539-3617561 AAGGCCTGGTCTCTGTTCTCAGG + Intergenic
1077638271 11:3858272-3858294 AAGGCATTCTAGCCTTCCTCAGG + Intronic
1077678530 11:4219013-4219035 AAGGGTTGCTCTACCTCCTCAGG + Intergenic
1077682100 11:4251319-4251341 AAGGGTTGCTCTACCTCCTCAGG - Intergenic
1077687933 11:4315416-4315438 AAGGGTTGCTCTACCTCCTCAGG + Intergenic
1078022577 11:7668138-7668160 AAAGACTGCTCTCTTTCTTCAGG + Intronic
1078480645 11:11672414-11672436 AGGCCCTGCAGTCCTTCCTCTGG - Intergenic
1079379434 11:19924465-19924487 AGGGCCTCTTCTGCTTCCTCTGG + Intronic
1079421992 11:20302159-20302181 ACGGCCTGCTCTCCTCTTTCTGG - Intergenic
1080575760 11:33597720-33597742 AGAGCCTTCTTTCCTTCCTCAGG - Intronic
1080728542 11:34922037-34922059 AAGGTCCTCTCTTCTTCCTCTGG - Intronic
1080750694 11:35147546-35147568 AAGGCCTGCATCCCTTCCTGTGG - Intronic
1081566846 11:44265580-44265602 GAGGTCTGCTCACCTTGCTCAGG - Intronic
1081604821 11:44520551-44520573 GAGGCCTGGCCTCCTTCCTTAGG + Intergenic
1083157938 11:60836898-60836920 AAGACCTCCTCTCCCTCCTCAGG - Intergenic
1083954820 11:65977482-65977504 AGGGCCTGCTCTGCCTTCTCAGG + Intronic
1084148158 11:67275829-67275851 GAGGCCTCCTCTCCTTCCCAAGG + Intronic
1084328087 11:68413363-68413385 AAGGCCTGGTCTCATTGCTGTGG + Intronic
1084380275 11:68807518-68807540 AAGTGCTGCTCTCCTACCACGGG - Exonic
1084400368 11:68939707-68939729 ACGTCCCCCTCTCCTTCCTCCGG - Exonic
1084480366 11:69416279-69416301 CAGGCCTGCACTCCTGCCCCTGG - Intergenic
1087116117 11:94526664-94526686 AAGGGCTGCTCCCCAGCCTCTGG - Intergenic
1088396561 11:109376272-109376294 AGGTCCTTCTCTCCTTGCTCAGG + Intergenic
1088959673 11:114650544-114650566 AAGTACTGTTCTCCTTCCCCAGG + Intergenic
1089640246 11:119843203-119843225 CAGGCCTGCTCTCCCTCTCCTGG - Intergenic
1089700523 11:120241356-120241378 CAGGCCTGCTCTGCTTCTTGGGG - Intronic
1090863387 11:130673836-130673858 AAGGCCTGCTCTCCTTCCTCTGG + Intronic
1091988918 12:4938517-4938539 AGAGCATTCTCTCCTTCCTCAGG + Intergenic
1092211851 12:6651426-6651448 GGGGCTTTCTCTCCTTCCTCTGG - Intronic
1094073282 12:26443577-26443599 AAGGCTTCATCTCCTTCATCTGG + Exonic
1094124712 12:27011959-27011981 GACGCCTGCTCTCCTGACTCAGG + Intronic
1095940908 12:47726176-47726198 AAGGCCCACTCTTCTTCCCCTGG + Intergenic
1096675626 12:53224261-53224283 AAGTCTTGCTCTACTTCCTGGGG - Intronic
1097754071 12:63389747-63389769 AGGCCCTGTTCTCCTGCCTCAGG - Intergenic
1098082504 12:66804028-66804050 AAGCGCTTCTCTCCATCCTCCGG - Intronic
1101559653 12:105844379-105844401 ATGGTCTCTTCTCCTTCCTCTGG - Intergenic
1101637897 12:106561329-106561351 GAAGCCTGCTCTCCTTCATGAGG - Intronic
1102247966 12:111367197-111367219 AAGGCCAGCTCCCCATCCTTTGG + Intronic
1103797015 12:123510172-123510194 CAGCTCTGCTCTCCTGCCTCCGG + Intronic
1104810877 12:131619779-131619801 AAAGCCTGCTCTCCTGCTGCAGG + Intergenic
1105407088 13:20142096-20142118 ACGGCCTGCTCCTCCTCCTCGGG + Exonic
1105678887 13:22705549-22705571 CAGGCCAGATCTCCTTGCTCAGG + Intergenic
1107631233 13:42344607-42344629 AAGCTCTTCTCTCCCTCCTCTGG - Intergenic
1111443273 13:88309549-88309571 CAGACTTCCTCTCCTTCCTCTGG - Intergenic
1111547014 13:89751795-89751817 AAGGCCTACTCTCCTTTCAGTGG - Intergenic
1111926500 13:94468916-94468938 AAGAACTGCTCTCTTTCCTGAGG + Exonic
1112730083 13:102351054-102351076 AGGGCCTCCTCTCCTTTCTCAGG + Intronic
1113677889 13:112220791-112220813 CAGGCCTGCTGTCCTCCCTGGGG - Intergenic
1115993877 14:39175590-39175612 AGGCCTCGCTCTCCTTCCTCAGG - Intronic
1116013781 14:39382107-39382129 ACTGCCTGCTCTCCATCGTCAGG + Intronic
1117899207 14:60515359-60515381 AAGGGGGGCTCTCCTTCCTCGGG - Intronic
1118685448 14:68286185-68286207 CCTGCCTGCTCTCCTTCCTAAGG - Intronic
1122129913 14:99598932-99598954 AAGGCCAGCCCTCCTTTCTGAGG + Intronic
1122649699 14:103219871-103219893 AAGGCCACCTCCCCTTCCCCTGG - Intergenic
1124069747 15:26380256-26380278 AAAGCCTGCTCACCTGCCCCAGG + Intergenic
1124090478 15:26595320-26595342 AAGATCTGCTCTGCTCCCTCTGG + Intronic
1125060922 15:35422719-35422741 AAATCCTCCTCTCCATCCTCTGG + Intronic
1126688089 15:51265776-51265798 AAGGACTGCCCTCTTTCCACAGG + Intronic
1127846935 15:62878281-62878303 AAGGCCTGCTCCCTGCCCTCTGG - Intergenic
1128473954 15:67981250-67981272 AAAGCCAGCTGTCTTTCCTCTGG + Intergenic
1129503848 15:76064562-76064584 AAGGCCTCCTCTCCTCCTCCCGG + Intronic
1129705635 15:77792520-77792542 AAGGCCTACTCCCTCTCCTCAGG + Intronic
1130118669 15:81027749-81027771 AAGGCCTCACCTCCTTCCTTAGG - Intronic
1130533940 15:84769568-84769590 AAGGCCTCCTTACGTTCCTCAGG - Intronic
1130580472 15:85133396-85133418 AAGGTCTGCTCTGCTCCCTCCGG + Intronic
1131222711 15:90598391-90598413 AAGAGCTGCTCCCCTTCCTTTGG + Intronic
1131657573 15:94477490-94477512 GCCGCCTGCCCTCCTTCCTCTGG - Intronic
1131900823 15:97085971-97085993 AAGGCGTGCTTTCCTTTCCCCGG + Intergenic
1132403912 15:101530827-101530849 AGGGCCTGCTCTGCTCCCTGCGG + Intergenic
1132716040 16:1290253-1290275 ACAGCCTGGTCTCCCTCCTCTGG + Intergenic
1134141377 16:11722511-11722533 AAGTCCAGCACTCTTTCCTCAGG - Intronic
1135254529 16:20930468-20930490 AGGGACTGGTCTCATTCCTCAGG - Intergenic
1135561491 16:23480078-23480100 AAGGCCTGCCTTCCTACCCCAGG + Intronic
1137274124 16:46922378-46922400 AAGGACTCCTCTCCTGCCACCGG - Exonic
1137429759 16:48408994-48409016 GAAGCCTGCTCTCCTTTCCCTGG + Intronic
1137694179 16:50450135-50450157 ATGGCCTGCTTGCCTTCCGCTGG + Intergenic
1138658098 16:58502113-58502135 AGGGCCTGCCCTCCCTACTCTGG + Intronic
1139314954 16:66060015-66060037 AAGACCTGGTCTCCTTCCCCGGG - Intergenic
1139491488 16:67288417-67288439 AAGCCATGCCCTCCTGCCTCTGG - Intronic
1141565206 16:84896991-84897013 AAGGCAAGCTCTTCCTCCTCAGG + Intronic
1141604154 16:85143427-85143449 GAGTCCTGCTCTTCTTCTTCGGG + Intergenic
1142360321 16:89623089-89623111 AGGGCCTCCTGACCTTCCTCTGG - Intronic
1142684939 17:1572215-1572237 TGGGCCTGCTCCCCTTCCTTGGG + Intronic
1142687754 17:1587504-1587526 TGGGCCTGCTCCCCTTCCTTGGG + Intronic
1142890101 17:2937602-2937624 GAGCCCTTCTCTCCTTCCCCTGG - Intronic
1143253132 17:5537293-5537315 AAGGCCACATCTCCTTCCTGGGG - Intronic
1143804495 17:9415124-9415146 GAGGCCTATTGTCCTTCCTCAGG - Intronic
1144336617 17:14277155-14277177 AAGGTCTACTCTGTTTCCTCTGG + Intergenic
1144585367 17:16484458-16484480 AATGCCTGCTCTCCTGCCCAAGG + Intronic
1144615545 17:16768123-16768145 AAGTCCTGCAGACCTTCCTCTGG + Intronic
1144897158 17:18547544-18547566 AAGTCCTGCAGACCTTCCTCTGG - Intergenic
1146468808 17:33108339-33108361 TGGGCCTGGCCTCCTTCCTCTGG + Intronic
1148072777 17:44917771-44917793 AAAGCCTCCTGTCCTTCCCCAGG - Intergenic
1148805295 17:50260869-50260891 GAGGCTTCCTCTCCATCCTCTGG + Intergenic
1148806834 17:50268149-50268171 CATGCCTGGCCTCCTTCCTCTGG - Intergenic
1149780107 17:59390651-59390673 AAGGACTGCTCACTTTCCCCAGG - Intronic
1150161942 17:62905968-62905990 AAGCCTTGCCCTCCTTCATCTGG + Intergenic
1150639461 17:66939677-66939699 AAGGGGTGCTCTCCCTCCTGCGG - Intergenic
1151303964 17:73251006-73251028 AGTGCCTGCTCTCCTGCCTGGGG - Intronic
1152230889 17:79113522-79113544 AAGGCCGTCTGTCCATCCTCTGG + Intronic
1152343484 17:79737938-79737960 AAGGCCTACTCTCCTGCCCAAGG + Exonic
1152911237 17:83005941-83005963 AGGACCTGCCCTCCTACCTCTGG - Intronic
1153101308 18:1473132-1473154 AAGGCCTCTTCTCCTGGCTCAGG + Intergenic
1156722916 18:40092362-40092384 AACCCCTTCTCTCCTTCTTCAGG - Intergenic
1158949509 18:62480126-62480148 TAGGTCTGCTCTGCTCCCTCTGG - Intergenic
1160168008 18:76530656-76530678 AACGCCTGGCCTCCTGCCTCAGG - Intergenic
1160982327 19:1822103-1822125 CAGGCCTGGCCTCCTCCCTCTGG - Intronic
1161468519 19:4445172-4445194 CAGGCCTGCTCTCCTGCCCAGGG + Exonic
1162011732 19:7820587-7820609 AAAGTCTGCTCTGCTCCCTCTGG - Intergenic
1162335065 19:10055225-10055247 AAGCCCTGCTCTGTTTCCCCAGG + Intergenic
1163026611 19:14516575-14516597 GAGGTCTGGTCTCCTTCCTTGGG + Exonic
1163303036 19:16459742-16459764 ACGGCCTGCTCCCCTGTCTCAGG - Intronic
1164400362 19:27897973-27897995 ATGCCCTGTTCTCCATCCTCTGG + Intergenic
1164518478 19:28957325-28957347 ATGAGCTGCTTTCCTTCCTCAGG - Intergenic
1165290743 19:34883226-34883248 AAGGTCTGCTCTGCTCCCTCTGG - Intergenic
1167048390 19:47065043-47065065 GAGGCCTGCTATCCTGCCTCTGG - Exonic
1167665175 19:50819450-50819472 AATCCCTGCCCACCTTCCTCTGG - Intronic
925451605 2:3973858-3973880 AAGCCCAGCTCTCCCTCCACGGG + Intergenic
926303342 2:11619067-11619089 GAGTCCTGCCCTCCTCCCTCCGG - Intronic
926784604 2:16507779-16507801 AAAGGCTGCTCTCATTCCTCAGG + Intergenic
927179971 2:20438456-20438478 AAGGGCAACTCTCCTTCCTCAGG - Intergenic
927501625 2:23587062-23587084 AAGGCCTGTTCTTCCTACTCTGG - Intronic
928803350 2:35121517-35121539 GAGGCCTGGGCTCCTTGCTCAGG - Intergenic
929596414 2:43179058-43179080 CACCCCTGCTCCCCTTCCTCCGG + Intergenic
929611951 2:43277226-43277248 AAGGCCCGATCTCCTTCTGCAGG - Intronic
929699391 2:44148920-44148942 AAGGCTGCCTCTCCTACCTCTGG - Intergenic
930052664 2:47228658-47228680 AATGCCTGGACTCCTTCCTGAGG - Intergenic
932613789 2:73219181-73219203 AAGTCCTGCTGTGCTCCCTCAGG - Intronic
933393605 2:81703998-81704020 AAAACCTGCTGTCCTACCTCAGG + Intergenic
933740722 2:85531867-85531889 AAAGCCTGCTTTCCTTGCACTGG + Intergenic
933863852 2:86498345-86498367 AAGGCCTGCTTTGTTCCCTCTGG + Intergenic
933997211 2:87678917-87678939 AAGGCCTCATCTTCTTCCTCTGG + Intergenic
935332704 2:101988729-101988751 AGAGCCTGCTCTCCCTCCACAGG - Intergenic
935346443 2:102112505-102112527 AAGCCCTGCCCTCCTTTCCCTGG - Intronic
936049078 2:109209481-109209503 CAGGCCTGCTCTCCCAGCTCAGG - Intronic
936296640 2:111271993-111272015 AAGGCCTCATCTTCTTCCTCTGG - Intergenic
936467162 2:112764133-112764155 AAGCCCGGGTCTCCTGCCTCTGG - Intronic
937307447 2:120881287-120881309 AAGGCCTGGCCCCCTTCCCCAGG + Intronic
938142974 2:128811782-128811804 AAGGCAGCCTCTCCTTTCTCTGG - Intergenic
939184093 2:138840382-138840404 TATGCCTTCTCTCCCTCCTCTGG + Intergenic
939184164 2:138840997-138841019 ATGGCCTGCTCTCCTCTATCTGG + Intergenic
939201065 2:139035194-139035216 ATGGTCTGCTCTTCTTCCTGAGG + Intergenic
943755475 2:191552579-191552601 AAGGCATTTTCTCATTCCTCCGG - Intergenic
945076646 2:206046558-206046580 GAGGCCTGCTCTGAGTCCTCTGG + Exonic
946157962 2:217819335-217819357 AAGGTCTGCTCTCCAGCCACTGG + Intronic
947706638 2:232281729-232281751 AATGCCTGCTCTTCCTCCCCTGG - Intronic
947856724 2:233329081-233329103 AAGGCTGGCTCTGGTTCCTCTGG + Intronic
948007463 2:234622057-234622079 AGGCCCTGTTCTCCTGCCTCAGG - Intergenic
948332350 2:237179786-237179808 CAGGCCTCCTCTCCTTCCTTGGG - Intergenic
948497620 2:238362577-238362599 AAGGCCTGCCCTTCTCCTTCAGG + Intronic
1169637552 20:7709310-7709332 AAAGCCTGTCCCCCTTCCTCAGG + Intergenic
1169830069 20:9815322-9815344 AATGCCTGCCATCATTCCTCAGG + Intronic
1170613797 20:17933719-17933741 AGAGCCTGCTCTCCTGGCTCTGG - Intergenic
1171308496 20:24126333-24126355 CTGGCCTCCTCTCCCTCCTCAGG + Intergenic
1172524753 20:35592636-35592658 TAGTCCTGCTTTCCCTCCTCTGG - Intergenic
1173639744 20:44592580-44592602 ACGGCCTGCCCTCCTTGCTGAGG - Intronic
1174187472 20:48716789-48716811 AAGGCATGCTCTCCTCTCCCTGG + Intronic
1174407314 20:50310656-50310678 GAGGCCTGCCCTCCCTCCTGGGG + Intergenic
1175501008 20:59450764-59450786 AATCCCTTCTCTCCATCCTCTGG + Intergenic
1175813835 20:61873398-61873420 CAGGCCTGCTCTGCTGCCCCAGG + Intronic
1176061018 20:63173020-63173042 AGGGCGCCCTCTCCTTCCTCAGG - Intergenic
1178753317 21:35324529-35324551 CAGGCCTGCTCTGCTTACACTGG + Intronic
1178912327 21:36685432-36685454 GAGGCCAGCTCTCCTGGCTCTGG - Intergenic
1181443202 22:22949265-22949287 GAGGCCTACTGGCCTTCCTCAGG + Intergenic
1181558638 22:23686737-23686759 CAGGGCTGCTCTCGTTCCCCTGG - Intergenic
1182747381 22:32616173-32616195 AGGGCCTGCTCTCCTGCATGGGG + Intronic
1182805569 22:33067115-33067137 AAGCTCTGCTCTCCTTCCAGGGG - Intergenic
1182941829 22:34284163-34284185 AAGGCCTTCTTTCCTTCTCCCGG + Intergenic
1183029561 22:35093348-35093370 GAGTCCTGCTCTCCCTCCTCTGG - Intergenic
1183248171 22:36709944-36709966 AGGGCCTGCTCTTCTCTCTCGGG + Intergenic
1183347596 22:37316544-37316566 ACTGCCTGCTCTGCGTCCTCTGG - Intergenic
1183464552 22:37973166-37973188 AGGGCCTGCTCACCCTCCTCGGG - Exonic
1184236707 22:43186987-43187009 AAGGCCTGCGCGCCCTCCTCCGG + Exonic
1184734562 22:46390486-46390508 CACACCTGCTCTCCTTCCCCAGG - Exonic
1185274152 22:49943191-49943213 AAGGCCAGCCCTCCTTCCCCCGG - Intergenic
950286733 3:11751045-11751067 AAGGACTCCTCCTCTTCCTCCGG - Intergenic
950602636 3:14048265-14048287 AAGATCTACTCTCCTTCCTCTGG + Intronic
950661928 3:14472055-14472077 CAGGCCTGGTCTCTTTCCCCAGG + Intronic
951211845 3:19983756-19983778 AAGGTCTACTCCTCTTCCTCTGG - Exonic
951528622 3:23678260-23678282 CAGCCCTGCTCACCTTCCTGGGG + Intergenic
951588782 3:24241476-24241498 ATGTCCTGCTCAACTTCCTCAGG + Intronic
953702839 3:45210169-45210191 GAAGCCTGCTCTCCTTTCTCTGG - Intergenic
954740184 3:52743392-52743414 AAGGGCTGGTCTTCTTCCTGGGG + Exonic
955285478 3:57636965-57636987 AAGGCCTTTTCTCCTTCCTATGG - Intronic
955305377 3:57825732-57825754 AAGGTCTGCTCTGCTCCCTCTGG + Intronic
955827296 3:62962082-62962104 AAGGATTGCTCTCTTGCCTCAGG + Intergenic
956088263 3:65636778-65636800 TATGCCTTCTCTCCTTTCTCTGG - Intronic
956165183 3:66393006-66393028 CAGGCCTGCTGAACTTCCTCTGG - Intronic
956750774 3:72342230-72342252 CAAGCCAGCTCTCCCTCCTCAGG + Intergenic
957808453 3:85184555-85184577 AAGACATGCTCTCTTTCCTTAGG + Intronic
959137700 3:102445111-102445133 GTGGACTGCTCTGCTTCCTCCGG + Intronic
961438013 3:126932636-126932658 AAGGACAGCCCTCCTTCCTGCGG - Intronic
961507820 3:127382946-127382968 AAGGTCTGCCCTCCTTCCACTGG - Intergenic
962277781 3:134029192-134029214 AAGGGATGTTCTCCTTCCCCAGG - Intronic
963076972 3:141355909-141355931 TGGGCTGGCTCTCCTTCCTCAGG - Intronic
967602937 3:191411014-191411036 AAGGTCTGCTATACTTCCTCTGG + Intergenic
967747747 3:193079309-193079331 AAGACAGGCTCTCCTTTCTCAGG - Intergenic
967922587 3:194623918-194623940 ACGTGCTGCCCTCCTTCCTCAGG + Intronic
969635916 4:8369513-8369535 AGGGCCTGCTGTCCTGCATCGGG - Intronic
971368460 4:25995840-25995862 TGGGCCTCCACTCCTTCCTCAGG - Intergenic
973030925 4:45337759-45337781 AAATCCTACTTTCCTTCCTCTGG - Intergenic
976872247 4:89809237-89809259 AAGGCCTACTCTTGTTACTCAGG - Intronic
976929035 4:90540461-90540483 CAGGCATGCTGACCTTCCTCTGG - Intronic
978816062 4:112907101-112907123 AGAGCCTGCTGTCCTTACTCAGG + Intronic
982408723 4:155048251-155048273 AAAGTTTGCTCTCCTTCCTGGGG + Intergenic
987858316 5:23450401-23450423 AAGGTCTGCTCTGCTCCCTCTGG - Intergenic
989265725 5:39471349-39471371 CATGACTGCTGTCCTTCCTCAGG + Intergenic
990346029 5:54872659-54872681 AAGGCCTTATCTGCTTCCTGGGG + Intergenic
991596951 5:68315891-68315913 CAGGCCTGCTGTACTGCCTCCGG + Intergenic
992421759 5:76613248-76613270 AAGGCCCACTCTCCTGCCCCTGG - Intronic
993495313 5:88602341-88602363 AAGACCTCTTCTCTTTCCTCAGG + Intergenic
993868508 5:93222690-93222712 AAGGCCTGGGACCCTTCCTCTGG + Intergenic
994672758 5:102782379-102782401 AAAATCTTCTCTCCTTCCTCTGG - Intronic
995104667 5:108361851-108361873 AAGGTCTGCTCTGTTCCCTCTGG + Intronic
996505861 5:124266975-124266997 AAGACATGCCCACCTTCCTCAGG + Intergenic
997079899 5:130725961-130725983 TGAGTCTGCTCTCCTTCCTCAGG - Intergenic
998347315 5:141476228-141476250 AAACCCTTCTCTCTTTCCTCCGG - Exonic
998459567 5:142299735-142299757 AAGGCCTTCTTACCTTCCTGAGG + Intergenic
998762592 5:145449139-145449161 AAGAGATGTTCTCCTTCCTCTGG - Intergenic
998866934 5:146515002-146515024 AAACCCAGCTCTCCCTCCTCTGG - Exonic
999231275 5:150063586-150063608 AAGACCTGATTTCCTTCCTTAGG + Intronic
999624785 5:153508947-153508969 AAGACCTGCTCTCCTTTTCCAGG + Intronic
1001752918 5:174145256-174145278 TAGGCCTCCTCTCCATTCTCAGG - Intronic
1002210617 5:177596805-177596827 AATGCCTGCCCCCCTCCCTCTGG + Intergenic
1002276568 5:178107911-178107933 ATGCCCAGCTCTCCTCCCTCAGG + Intergenic
1002419619 5:179138825-179138847 TCGGGCTGCTCTCCTTGCTCTGG - Intronic
1002906810 6:1455869-1455891 AAGCCCTGCTCTCCTTTGTACGG + Intergenic
1003455820 6:6281308-6281330 AAGACCTTGTCTTCTTCCTCAGG + Intronic
1003634552 6:7820635-7820657 AGGGCATGCTCACCTGCCTCGGG - Intronic
1004143984 6:13047675-13047697 ATGGGCTGCCCTCCTGCCTCTGG + Intronic
1004269329 6:14179805-14179827 AGGGCCAGCTCTGCTTCCTGGGG + Intergenic
1007180996 6:39929177-39929199 AAGCCCTGCTCACCATCCTGTGG + Intronic
1007531537 6:42547411-42547433 AGTGCCTGCTGCCCTTCCTCTGG + Intergenic
1009450815 6:63798568-63798590 ATAGCCTGCTCTCATTCATCAGG + Intronic
1010085793 6:71916464-71916486 ACTGCCTGCTCTCCTTCCAGTGG + Intronic
1010289293 6:74116613-74116635 AATGCCCCCTCTCTTTCCTCTGG + Intergenic
1011456639 6:87557636-87557658 AATTCCTTCCCTCCTTCCTCAGG + Intronic
1011575189 6:88789799-88789821 AAAGCCTGTTATCCATCCTCTGG - Intronic
1011734521 6:90297309-90297331 GACGTCTGCTCTCCTTCCCCAGG - Intergenic
1012969312 6:105710551-105710573 AACTCCTGCTCTCCTTCATGGGG - Intergenic
1016548398 6:145249362-145249384 AACTCCTGATCTCCTTGCTCAGG + Intergenic
1016706231 6:147111206-147111228 AATGCCTGTTCTTCTACCTCTGG + Intergenic
1016987699 6:149907487-149907509 AGGGCCTGTTCCCCTGCCTCAGG - Intergenic
1017433621 6:154395087-154395109 AAGCCCTGCTCTCCTGCCCTGGG - Exonic
1017792922 6:157817371-157817393 GAGTCCTGTTCTCCTTCCCCAGG - Intronic
1017878806 6:158545444-158545466 AAGGGCTGATCGCCTGCCTCTGG + Intronic
1018153367 6:160961523-160961545 AATGCCTGCTCTCATCACTCAGG + Intergenic
1018856704 6:167680159-167680181 AAGGGCTGCTTTGCTGCCTCTGG + Intergenic
1018910413 6:168098317-168098339 TAGGCCTGCTCTTCCTCCCCGGG + Intergenic
1019167972 6:170111525-170111547 AAGGGCTGGGCTCCTTACTCAGG - Intergenic
1019527955 7:1489280-1489302 AGGGCCTGGTCTCGTTCCGCTGG - Intronic
1019576502 7:1740175-1740197 AGGGCCTGGCCTCCTGCCTCAGG - Intronic
1019698312 7:2460231-2460253 AGGGCCCGCTCCCCTTCCTGGGG + Intergenic
1020005949 7:4783880-4783902 GAGGCCTGCTGTCGTTCCGCGGG + Intronic
1020810957 7:12849251-12849273 AAGGCCTGCTATCCTACATATGG - Intergenic
1021535822 7:21703280-21703302 ATGTTCTGCTCTCCTTCCTGGGG + Intronic
1022024192 7:26430539-26430561 TAGGCTTGCTCTTCTTGCTCTGG - Intergenic
1022573845 7:31479021-31479043 GAGGTCTTCTCTCCTTTCTCTGG - Intergenic
1022587611 7:31629416-31629438 ATGGCCTGTTTTCCTTCCCCTGG + Intronic
1023625513 7:42111587-42111609 CAGGCCTGCTCTCCTGCCTTTGG - Intronic
1023842638 7:44105690-44105712 CAGGCTTGCTCTCCTGGCTCTGG + Intronic
1026847575 7:73706388-73706410 AAGGCAGGCTCTGCCTCCTCTGG - Intronic
1028890908 7:95987624-95987646 AACCCCTGCTCTTCTTCCTGAGG + Intronic
1030039801 7:105439440-105439462 AAGCTCTGCTCTCCTTCACCTGG + Intergenic
1030322376 7:108182614-108182636 AAGGCCATTTCTCCTTGCTCAGG - Intronic
1031034746 7:116776214-116776236 AAGGCCTTCTCACTTTCCTGTGG + Intronic
1032668679 7:134063946-134063968 AATGCCTTCTCTCCTTCTTCAGG + Intronic
1034825485 7:154258447-154258469 CTGGTCTGCTCTCCTTCCACGGG - Intronic
1036712249 8:11087542-11087564 GAGACCTCCTCTCCTTCCTCTGG + Intronic
1037033083 8:14133504-14133526 AAGGTCTTCTCTGCTTCCTCTGG + Intronic
1037765220 8:21768554-21768576 AAGGCTGGGTCTCCTGCCTCCGG + Intronic
1038427820 8:27476001-27476023 AAGCCTTAGTCTCCTTCCTCAGG - Intronic
1039430018 8:37518919-37518941 AAGGCATGATCTCCATCCTGAGG + Intergenic
1039779438 8:40770002-40770024 CAGGCCTGTTTTCCTCCCTCGGG + Intronic
1040110987 8:43567134-43567156 CTGGCCTCCTCTCCTTCCACGGG + Intergenic
1040365511 8:46711027-46711049 AATGTCTGCTTTCCTTCCCCTGG - Intergenic
1043454851 8:80402882-80402904 AGGTCCTGCTCTTCTTCCACGGG + Intergenic
1043974838 8:86572942-86572964 AATACCTGCCCTTCTTCCTCTGG - Intronic
1043999134 8:86856740-86856762 AAGGCATTTTCTCCTTCTTCGGG - Intergenic
1044584987 8:93861022-93861044 CAGGCTTGGTTTCCTTCCTCAGG + Intronic
1044717471 8:95113589-95113611 AAGCCCTGCTTGCCTTCCTGAGG + Intronic
1046624528 8:116562629-116562651 AAGGCTTTCTCTCCTCCCTCTGG + Intergenic
1047045162 8:121045023-121045045 AAGGCCTTCTCTACTTACTCTGG + Intergenic
1047105157 8:121724053-121724075 AAGCCATGGTCTCCATCCTCAGG - Intergenic
1048950139 8:139489823-139489845 AAGGACAGCTCACCATCCTCAGG + Intergenic
1049215612 8:141406482-141406504 AAGTCCTGCCCTCCTGCCTCTGG + Intronic
1049253307 8:141600858-141600880 CAGGCCTGCTCTACTTCTTCTGG + Intergenic
1049549754 8:143251684-143251706 CAGGACTGCTCTCCATCATCCGG - Intronic
1051389855 9:16552424-16552446 AAGGGCTGCACACCCTCCTCTGG - Intronic
1051437150 9:17044866-17044888 AAGGGCATCTCTGCTTCCTCGGG + Intergenic
1051509064 9:17857595-17857617 ATGGCTTGCTCTGCTGCCTCTGG + Intergenic
1052506630 9:29362966-29362988 AATGCTTGCTTTCCTTCCTGAGG + Intergenic
1052774801 9:32722618-32722640 AAGCCCAGCTCTCTTACCTCTGG - Intergenic
1052984522 9:34476747-34476769 AATGCCTCCTCTCTTTCCTTAGG - Intronic
1055278434 9:74646168-74646190 AAGTCCTGATCTGCTTCCTCTGG + Intronic
1057040806 9:91846111-91846133 AAGGCCTGCTGTTCTCTCTCTGG + Intronic
1057604655 9:96490201-96490223 ATGGCCTGCTCTCGAGCCTCTGG - Exonic
1058458114 9:105157319-105157341 GAGGCCTGCCCTCCATCATCTGG + Intergenic
1058555453 9:106161925-106161947 AAGCCTTGCACTCATTCCTCTGG + Intergenic
1059235326 9:112755861-112755883 AAGGAGTGCTCTCCTTCTGCTGG - Intronic
1060998303 9:127887321-127887343 TAGGCTTCTTCTCCTTCCTCAGG - Intronic
1061225223 9:129277337-129277359 ATTGCGTGCTCTGCTTCCTCAGG + Intergenic
1061898769 9:133662376-133662398 ATGGCCTGGCCTGCTTCCTCCGG - Intergenic
1061954540 9:133955025-133955047 AAGGCAGACACTCCTTCCTCCGG + Intronic
1187131435 X:16506992-16507014 AAGGGCCACCCTCCTTCCTCCGG + Intergenic
1187441851 X:19327947-19327969 ACGAACTGCCCTCCTTCCTCCGG + Intergenic
1187522508 X:20026055-20026077 AAGCCCTATTTTCCTTCCTCTGG - Intronic
1188693630 X:33160390-33160412 AAGGAAGGCTCTACTTCCTCAGG + Intronic
1190006556 X:46745233-46745255 AAGCCCTGCTCTGCTCCATCTGG - Intronic
1190074950 X:47310098-47310120 AAGGTCTTCTCCCCTTCCCCTGG + Intergenic
1191864155 X:65690457-65690479 AAGGGCTGCTCACCTCCCTTGGG - Intronic
1193076310 X:77359688-77359710 AATGCAAGCTCTCCTTCCTTTGG - Intergenic
1194198589 X:90927448-90927470 AAGGTCTGCTCTACTCTCTCTGG + Intergenic
1194580074 X:95661116-95661138 AAGGTCCACTGTCCTTCCTCAGG - Intergenic
1196140011 X:112250782-112250804 CAGGTCTGATCTTCTTCCTCTGG - Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1197010947 X:121562695-121562717 AAGGCCTTCTCTCATGCCTCTGG - Intergenic
1197256893 X:124273191-124273213 AATGCCTCCTCTCCTTTCACTGG + Intronic
1199537369 X:148917978-148918000 ATTGCCTGATCTCCTCCCTCGGG + Intronic
1200225807 X:154416785-154416807 TGGGACTGCTCTCCTTCCACAGG - Intronic
1200544584 Y:4503893-4503915 AAGGTCTGCTCTACTCTCTCTGG + Intergenic