ID: 1090866551

View in Genome Browser
Species Human (GRCh38)
Location 11:130705748-130705770
Sequence CGGGGCAGTTGGCAGAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090866538_1090866551 27 Left 1090866538 11:130705698-130705720 CCCAGGGCGGTCAGTGGAACCTC 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1090866551 11:130705748-130705770 CGGGGCAGTTGGCAGAAACTTGG 0: 1
1: 0
2: 0
3: 9
4: 119
1090866543_1090866551 8 Left 1090866543 11:130705717-130705739 CCTCTTAGATCACCTGGGGCTGA 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1090866551 11:130705748-130705770 CGGGGCAGTTGGCAGAAACTTGG 0: 1
1: 0
2: 0
3: 9
4: 119
1090866546_1090866551 -4 Left 1090866546 11:130705729-130705751 CCTGGGGCTGAATCCAGGACGGG 0: 1
1: 0
2: 0
3: 22
4: 164
Right 1090866551 11:130705748-130705770 CGGGGCAGTTGGCAGAAACTTGG 0: 1
1: 0
2: 0
3: 9
4: 119
1090866539_1090866551 26 Left 1090866539 11:130705699-130705721 CCAGGGCGGTCAGTGGAACCTCT 0: 1
1: 0
2: 1
3: 6
4: 69
Right 1090866551 11:130705748-130705770 CGGGGCAGTTGGCAGAAACTTGG 0: 1
1: 0
2: 0
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090866551 Original CRISPR CGGGGCAGTTGGCAGAAACT TGG Intronic
900670033 1:3846370-3846392 GAGGGCAGCTGGCACAAACTGGG + Intronic
903021734 1:20399817-20399839 CAGGGAAGTTGGCAGATACGTGG + Intergenic
903191265 1:21657654-21657676 CGGGGCAGTTGGACAAAGCTGGG + Intronic
907048643 1:51315175-51315197 CCGGGCAGCTGGCAGAAATGTGG + Intronic
912806209 1:112758921-112758943 CGAAGAAGTTGGCAGAAATTGGG + Intergenic
912965199 1:114230954-114230976 TGGGCAAGTTGGCAGAAAGTTGG - Intergenic
915934755 1:160083958-160083980 CGCGGCAGGTGGCAGCAGCTCGG + Exonic
920674903 1:208031920-208031942 CTGGGGAGGTGGGAGAAACTGGG + Intronic
1063126792 10:3142838-3142860 CAGGGCAGTGGGGAGAAACCAGG - Intronic
1067741408 10:48898372-48898394 CAGGGCAGCTGGCAGAAAAGGGG + Intronic
1073013839 10:100382541-100382563 CGGTGCAGATGGGACAAACTGGG - Intergenic
1075631072 10:124001029-124001051 CGGGCCAGGGGCCAGAAACTTGG - Intergenic
1075796504 10:125123827-125123849 CTGGGCAGCTGGCAGCACCTGGG - Intronic
1076629413 10:131843215-131843237 CTGGGCAGCTGTCAGAACCTGGG - Intergenic
1076830593 10:132992409-132992431 AGGGGCTGCTGGCAGAAGCTGGG + Intergenic
1077929946 11:6720743-6720765 CGGAGCAGTTGGCAGAAGTGAGG - Intergenic
1078277595 11:9864959-9864981 CAGTGCAGTTGGCACAATCTTGG + Intronic
1078923312 11:15851522-15851544 AGGGGCACTTGGAAGAAACCAGG - Intergenic
1084333953 11:68446285-68446307 CTGGCCAGTTGGCAAAACCTGGG - Intronic
1086845502 11:91744687-91744709 CCAGGCAGTTGGAAGAAACATGG - Intergenic
1089007119 11:115101513-115101535 CAGGGCAGTTGGCAGAGATGGGG - Intergenic
1089933760 11:122342275-122342297 TGGGGCAGTTGACAGAGCCTGGG - Intergenic
1090866551 11:130705748-130705770 CGGGGCAGTTGGCAGAAACTTGG + Intronic
1094481126 12:30882216-30882238 GGGTGCAGTAGGAAGAAACTGGG + Intergenic
1097069274 12:56343088-56343110 CAGGGCAGTTGACAGGTACTTGG - Exonic
1102619468 12:114182572-114182594 CGGGGCAGTTGGCAGCGGGTGGG + Intergenic
1102680654 12:114688253-114688275 TGGGGCACTGGGCAGAAACGAGG - Intergenic
1103705616 12:122870240-122870262 CGGGGCAGTTACCAGAAAAGGGG - Intronic
1115848562 14:37567050-37567072 CGGAGAAGATGGCAGTAACTTGG - Intergenic
1117024715 14:51607810-51607832 CGTGGCACTCGGCAGAAACCGGG - Intronic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1120858679 14:89235060-89235082 GGGGGCAGTTGCCAGAGAGTGGG - Intronic
1122034612 14:98938240-98938262 CGGGGCAGAAGGCAGAGACTGGG + Intergenic
1123122793 14:105925846-105925868 CGGGGCCGTTGGCAGAGGCTGGG - Intronic
1123405438 15:20017266-20017288 CGGGGCCGTTGGCAGAGGCTGGG - Intergenic
1123514769 15:21023914-21023936 CGGGGCCGTTGGCAGAGGCTGGG - Intergenic
1132617432 16:848715-848737 CGGGGCTGCTGGCAGGAACAGGG - Intergenic
1132626127 16:892479-892501 GTGAGCAGTTGGCAGGAACTGGG + Intronic
1134133677 16:11666404-11666426 TGGGGCAGCTGGCTGAAGCTGGG + Intergenic
1135471704 16:22737065-22737087 AAGGGCAGTTAGCAAAAACTGGG - Intergenic
1139379375 16:66520986-66521008 GGGGCCAGTTAGCAGCAACTGGG + Intronic
1141746659 16:85930801-85930823 CGGGGCAGCAGGCTGAAGCTGGG + Intergenic
1145922709 17:28622742-28622764 GTGAGCAGTTGGCAGAAACAAGG - Intronic
1149439334 17:56661958-56661980 AGGGGCAGGTGACAGAAAATGGG - Intergenic
1149868367 17:60162818-60162840 CGGGGCACTTGTCAGAACCTGGG + Intronic
1151271154 17:72996957-72996979 CAAGGCAGATGGCAGACACTTGG + Intronic
1155696450 18:28692271-28692293 CTGGGCAGTGGGCAAAAACCTGG + Intergenic
1156027455 18:32670942-32670964 CTGGCCAGATGGCAGAAAGTTGG + Intergenic
1156610025 18:38714886-38714908 AGGGACAGTTGGCAAAACCTTGG - Intergenic
1160795792 19:944927-944949 CGGGGCGGGTGGCAGAGACAGGG - Intronic
1160987324 19:1845067-1845089 CGGGGCAGTGGGCAGAGGCCTGG + Intronic
1161134798 19:2613463-2613485 CGGGGCAGATGGCATAAACCAGG + Intronic
1162648877 19:12069902-12069924 CAGTGCAGTTGGCGCAAACTTGG - Intronic
1164856838 19:31531405-31531427 GGGGGCAGTTAACAGAGACTAGG - Intergenic
926036745 2:9641761-9641783 GGTGGCAGTTGCCAGGAACTAGG - Intergenic
930805917 2:55490320-55490342 AGGGGCAGTTGTGAGACACTGGG - Intergenic
934765141 2:96876346-96876368 CAGGGCAGTGGGCAGCACCTGGG - Intronic
938917277 2:135955047-135955069 CTTGGCAGTTGGTAGAGACTGGG + Intronic
944645834 2:201780628-201780650 CGGGGCAAGTGGGAGAACCTGGG + Intronic
947483024 2:230520630-230520652 CGGTGTAGTTGGCAGAATTTTGG - Intronic
948690976 2:239704929-239704951 CGGGGCAGTTCTGAGAACCTGGG + Intergenic
1172310743 20:33916270-33916292 TGGGGCAAGTGGCAGAAACAAGG - Intergenic
1173658443 20:44716775-44716797 CGGGGCAGGAGGCAGACACCTGG + Intronic
1174379898 20:50149712-50149734 CAGGGCAGGTGGCAGAGAATGGG - Intronic
1175445304 20:59015779-59015801 TGGGGCAGTTGGCAAAAAGGAGG - Intergenic
1175974709 20:62704754-62704776 TGGGGCTGTTGGCAGATTCTGGG - Intergenic
1175979258 20:62728812-62728834 GGGTGCAGGTGACAGAAACTGGG - Intronic
1176299364 21:5091224-5091246 CAGGGCAGATGGGGGAAACTGGG + Intergenic
1176305709 21:5122053-5122075 CGGAGCAGCTGGCAGAACCCGGG + Intronic
1177638931 21:23821287-23821309 CTGGGGAGATGGCTGAAACTAGG + Intergenic
1179851348 21:44139978-44140000 CGGAGCAGCTGGCAGAACCCGGG - Intronic
1179857662 21:44170723-44170745 CAGGGCAGATGGGGGAAACTGGG - Intergenic
1180159661 21:45993373-45993395 CGGGGCAGCTGGCAGACTCCGGG + Intronic
1181047628 22:20223098-20223120 AGGGGCAGATGGGAGCAACTTGG + Intergenic
1181315488 22:21968428-21968450 GGGGGCAGTGGGAAGAGACTGGG - Intronic
1184093592 22:42304923-42304945 CGGGGCCCCTGGTAGAAACTGGG - Intronic
1184341021 22:43885964-43885986 CGGGGCAGTGGGCAAAGACCTGG + Intronic
950011276 3:9725841-9725863 GTGGGCAGTGGGCAGGAACTGGG - Intronic
953282765 3:41574968-41574990 CAGGGCTGTGGACAGAAACTGGG - Intronic
953479173 3:43234653-43234675 CGGTGAAGTTGTCAGGAACTCGG - Intergenic
955784959 3:62527646-62527668 CAGAGCAGTTGGGAGAAACTTGG + Intronic
959553161 3:107687236-107687258 GAGGGCAGTTTGCATAAACTGGG + Intronic
959628586 3:108482175-108482197 CAGGGCAATTGGGAGAACCTAGG + Intronic
963441933 3:145351368-145351390 CTGGGCATTGTGCAGAAACTAGG - Intergenic
964168646 3:153739619-153739641 CTGGGCAGAGGGCAGGAACTTGG - Intergenic
964763302 3:160154650-160154672 TGGGGAAGTTTACAGAAACTGGG - Intergenic
966322706 3:178718706-178718728 TGGGGCAGTGGAAAGAAACTGGG - Intronic
968069983 3:195778771-195778793 CGAGGCAGTTGGCAGCTACCTGG + Exonic
968213405 3:196868044-196868066 CGGGGCAGCTGCCAGGAACGAGG + Exonic
969206844 4:5653589-5653611 AGGGGCATTTGGTAAAAACTAGG + Intronic
969242360 4:5908457-5908479 CTGGGGAGTTGGCAGCGACTAGG + Intronic
971400858 4:26274164-26274186 TGGGGCAGATGGCAGAAGATAGG - Intronic
978546268 4:109875462-109875484 AGGGGCAGTTGACAGTAACCAGG - Intergenic
981544615 4:145881477-145881499 CCAAGCAGTTGACAGAAACTTGG - Intronic
985915984 5:2919630-2919652 AGGGTGAGTTGGCAGGAACTGGG - Intergenic
988563090 5:32298350-32298372 GGGTGCTGTTGGCAGAAGCTGGG + Intronic
988902194 5:35745464-35745486 CGGGGCTGTTGGCAGAGGCCCGG + Intronic
994332779 5:98526844-98526866 AGGGGCTGTGGGCAGAAGCTGGG - Intergenic
995233780 5:109801331-109801353 CATGGCAGTTGGGATAAACTGGG + Intronic
997863154 5:137437926-137437948 GGTGGCAGTTGCCAGGAACTGGG - Intronic
998487150 5:142512759-142512781 CGGGGAAGTAGGCAGGAACCAGG - Intergenic
1006773118 6:36570367-36570389 CTGGGCAGGTTGCATAAACTTGG + Intergenic
1006931679 6:37692538-37692560 CTGGGCAGCTGGGAGAAGCTGGG + Intronic
1007616812 6:43184690-43184712 CCAGGCAGCTGGCAGAAAGTGGG + Exonic
1011070677 6:83378703-83378725 TGTGGCAGTTAGCAGATACTTGG + Intronic
1017598722 6:156058546-156058568 CAGGGCATGTGTCAGAAACTGGG - Intergenic
1021604682 7:22397840-22397862 GGGGGCAATTAGAAGAAACTAGG + Intergenic
1023297929 7:38735897-38735919 AGGGGCAGTTGGGAGGAACAGGG + Intronic
1024940585 7:54759234-54759256 GCGGGCTGTTGGCAGAAACCCGG - Exonic
1025029672 7:55547015-55547037 CTGGGCGGTTGGCAGAATGTGGG - Intronic
1026896912 7:74014580-74014602 CAGGGCCGTTTGGAGAAACTGGG - Intergenic
1032741431 7:134743147-134743169 AAGTGCAGTTGGCGGAAACTTGG + Intergenic
1033383080 7:140843372-140843394 CAGGTCAGTTGTCAGATACTTGG - Intronic
1034721683 7:153299514-153299536 CGGGGCAGTGGGGAGAACCGGGG + Intergenic
1035309151 7:157953731-157953753 CGGGGCAGCTGGTGGAAGCTGGG + Intronic
1045338611 8:101231945-101231967 CAGAGCAGCTGGCACAAACTTGG - Intergenic
1047184257 8:122617599-122617621 CGTGGCAGTTGGCTGCAACCTGG - Intergenic
1048001704 8:130384424-130384446 CTGGGCAGGGGGCAGAAAGTGGG + Intronic
1049269105 8:141684739-141684761 CTGGGCAGAGGGCAGACACTGGG - Intergenic
1049574221 8:143383020-143383042 CTGGGCACCAGGCAGAAACTTGG - Exonic
1050342498 9:4654697-4654719 CGGGGCAGTTGGAAGAGAGCCGG - Intronic
1050552384 9:6758895-6758917 CGGGGCTGTAGGCAGGAGCTTGG + Intronic
1057778151 9:98027510-98027532 CAGAGCAGTTGGAAGAAACCAGG + Intergenic
1187580022 X:20597344-20597366 CTGGTCAGTTGGAAGAAAATGGG + Intergenic
1188376684 X:29439343-29439365 CAGGAGAGCTGGCAGAAACTTGG + Intronic
1189281453 X:39822072-39822094 TGGGGCGCTTGGCAGAAACGCGG - Intergenic
1194917699 X:99724431-99724453 CAAGGCAGTTGGCAGAAAATGGG - Intergenic
1196760575 X:119197455-119197477 AGGGGCATTTGGCAAAATCTGGG - Intergenic
1199651502 X:149949321-149949343 AAGGGCAGCTGGCAAAAACTGGG - Intergenic