ID: 1090866551

View in Genome Browser
Species Human (GRCh38)
Location 11:130705748-130705770
Sequence CGGGGCAGTTGGCAGAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090866546_1090866551 -4 Left 1090866546 11:130705729-130705751 CCTGGGGCTGAATCCAGGACGGG 0: 1
1: 0
2: 0
3: 22
4: 164
Right 1090866551 11:130705748-130705770 CGGGGCAGTTGGCAGAAACTTGG 0: 1
1: 0
2: 0
3: 9
4: 119
1090866539_1090866551 26 Left 1090866539 11:130705699-130705721 CCAGGGCGGTCAGTGGAACCTCT 0: 1
1: 0
2: 1
3: 6
4: 69
Right 1090866551 11:130705748-130705770 CGGGGCAGTTGGCAGAAACTTGG 0: 1
1: 0
2: 0
3: 9
4: 119
1090866538_1090866551 27 Left 1090866538 11:130705698-130705720 CCCAGGGCGGTCAGTGGAACCTC 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1090866551 11:130705748-130705770 CGGGGCAGTTGGCAGAAACTTGG 0: 1
1: 0
2: 0
3: 9
4: 119
1090866543_1090866551 8 Left 1090866543 11:130705717-130705739 CCTCTTAGATCACCTGGGGCTGA 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1090866551 11:130705748-130705770 CGGGGCAGTTGGCAGAAACTTGG 0: 1
1: 0
2: 0
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090866551 Original CRISPR CGGGGCAGTTGGCAGAAACT TGG Intronic