ID: 1090869565

View in Genome Browser
Species Human (GRCh38)
Location 11:130731229-130731251
Sequence GATTGGGGCCCCGCTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090869557_1090869565 13 Left 1090869557 11:130731193-130731215 CCACATCATGTGGATTCAAAATC No data
Right 1090869565 11:130731229-130731251 GATTGGGGCCCCGCTGGGTGTGG No data
1090869556_1090869565 16 Left 1090869556 11:130731190-130731212 CCTCCACATCATGTGGATTCAAA No data
Right 1090869565 11:130731229-130731251 GATTGGGGCCCCGCTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090869565 Original CRISPR GATTGGGGCCCCGCTGGGTG TGG Intergenic
No off target data available for this crispr