ID: 1090873210

View in Genome Browser
Species Human (GRCh38)
Location 11:130766326-130766348
Sequence AGTGATCTGCAGGGGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090873210_1090873215 -3 Left 1090873210 11:130766326-130766348 CCTGCCTTCCCCTGCAGATCACT No data
Right 1090873215 11:130766346-130766368 ACTCATGTGCACTGACTATCTGG No data
1090873210_1090873217 8 Left 1090873210 11:130766326-130766348 CCTGCCTTCCCCTGCAGATCACT No data
Right 1090873217 11:130766357-130766379 CTGACTATCTGGATGGCACCTGG No data
1090873210_1090873216 1 Left 1090873210 11:130766326-130766348 CCTGCCTTCCCCTGCAGATCACT No data
Right 1090873216 11:130766350-130766372 ATGTGCACTGACTATCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090873210 Original CRISPR AGTGATCTGCAGGGGAAGGC AGG (reversed) Intergenic
No off target data available for this crispr