ID: 1090873215

View in Genome Browser
Species Human (GRCh38)
Location 11:130766346-130766368
Sequence ACTCATGTGCACTGACTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090873204_1090873215 27 Left 1090873204 11:130766296-130766318 CCTGGACCCATCCTCTCTTCCTT No data
Right 1090873215 11:130766346-130766368 ACTCATGTGCACTGACTATCTGG No data
1090873205_1090873215 21 Left 1090873205 11:130766302-130766324 CCCATCCTCTCTTCCTTTGTTCG No data
Right 1090873215 11:130766346-130766368 ACTCATGTGCACTGACTATCTGG No data
1090873208_1090873215 8 Left 1090873208 11:130766315-130766337 CCTTTGTTCGCCCTGCCTTCCCC No data
Right 1090873215 11:130766346-130766368 ACTCATGTGCACTGACTATCTGG No data
1090873207_1090873215 16 Left 1090873207 11:130766307-130766329 CCTCTCTTCCTTTGTTCGCCCTG No data
Right 1090873215 11:130766346-130766368 ACTCATGTGCACTGACTATCTGG No data
1090873203_1090873215 28 Left 1090873203 11:130766295-130766317 CCCTGGACCCATCCTCTCTTCCT No data
Right 1090873215 11:130766346-130766368 ACTCATGTGCACTGACTATCTGG No data
1090873211_1090873215 -7 Left 1090873211 11:130766330-130766352 CCTTCCCCTGCAGATCACTCATG No data
Right 1090873215 11:130766346-130766368 ACTCATGTGCACTGACTATCTGG No data
1090873210_1090873215 -3 Left 1090873210 11:130766326-130766348 CCTGCCTTCCCCTGCAGATCACT No data
Right 1090873215 11:130766346-130766368 ACTCATGTGCACTGACTATCTGG No data
1090873209_1090873215 -2 Left 1090873209 11:130766325-130766347 CCCTGCCTTCCCCTGCAGATCAC No data
Right 1090873215 11:130766346-130766368 ACTCATGTGCACTGACTATCTGG No data
1090873206_1090873215 20 Left 1090873206 11:130766303-130766325 CCATCCTCTCTTCCTTTGTTCGC No data
Right 1090873215 11:130766346-130766368 ACTCATGTGCACTGACTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090873215 Original CRISPR ACTCATGTGCACTGACTATC TGG Intergenic
No off target data available for this crispr