ID: 1090873217

View in Genome Browser
Species Human (GRCh38)
Location 11:130766357-130766379
Sequence CTGACTATCTGGATGGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090873207_1090873217 27 Left 1090873207 11:130766307-130766329 CCTCTCTTCCTTTGTTCGCCCTG No data
Right 1090873217 11:130766357-130766379 CTGACTATCTGGATGGCACCTGG No data
1090873208_1090873217 19 Left 1090873208 11:130766315-130766337 CCTTTGTTCGCCCTGCCTTCCCC No data
Right 1090873217 11:130766357-130766379 CTGACTATCTGGATGGCACCTGG No data
1090873214_1090873217 -2 Left 1090873214 11:130766336-130766358 CCTGCAGATCACTCATGTGCACT No data
Right 1090873217 11:130766357-130766379 CTGACTATCTGGATGGCACCTGG No data
1090873210_1090873217 8 Left 1090873210 11:130766326-130766348 CCTGCCTTCCCCTGCAGATCACT No data
Right 1090873217 11:130766357-130766379 CTGACTATCTGGATGGCACCTGG No data
1090873213_1090873217 -1 Left 1090873213 11:130766335-130766357 CCCTGCAGATCACTCATGTGCAC No data
Right 1090873217 11:130766357-130766379 CTGACTATCTGGATGGCACCTGG No data
1090873209_1090873217 9 Left 1090873209 11:130766325-130766347 CCCTGCCTTCCCCTGCAGATCAC No data
Right 1090873217 11:130766357-130766379 CTGACTATCTGGATGGCACCTGG No data
1090873212_1090873217 0 Left 1090873212 11:130766334-130766356 CCCCTGCAGATCACTCATGTGCA No data
Right 1090873217 11:130766357-130766379 CTGACTATCTGGATGGCACCTGG No data
1090873211_1090873217 4 Left 1090873211 11:130766330-130766352 CCTTCCCCTGCAGATCACTCATG No data
Right 1090873217 11:130766357-130766379 CTGACTATCTGGATGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090873217 Original CRISPR CTGACTATCTGGATGGCACC TGG Intergenic
No off target data available for this crispr