ID: 1090878292

View in Genome Browser
Species Human (GRCh38)
Location 11:130811122-130811144
Sequence CTCACGTGGTGGAAGTTGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090878288_1090878292 -8 Left 1090878288 11:130811107-130811129 CCTTGTTGCTGCGTCCTCACGTG No data
Right 1090878292 11:130811122-130811144 CTCACGTGGTGGAAGTTGAACGG No data
1090878285_1090878292 18 Left 1090878285 11:130811081-130811103 CCTTATTCTCTGCTTCCAAGATG No data
Right 1090878292 11:130811122-130811144 CTCACGTGGTGGAAGTTGAACGG No data
1090878287_1090878292 3 Left 1090878287 11:130811096-130811118 CCAAGATGGTGCCTTGTTGCTGC 0: 32
1: 119
2: 241
3: 329
4: 476
Right 1090878292 11:130811122-130811144 CTCACGTGGTGGAAGTTGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090878292 Original CRISPR CTCACGTGGTGGAAGTTGAA CGG Intergenic
No off target data available for this crispr