ID: 1090882923

View in Genome Browser
Species Human (GRCh38)
Location 11:130850041-130850063
Sequence TTCAACACATGAATTTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4458
Summary {0: 3, 1: 40, 2: 326, 3: 1321, 4: 2768}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090882923_1090882932 14 Left 1090882923 11:130850041-130850063 CCCCCACAAATTCATGTGTTGAA 0: 3
1: 40
2: 326
3: 1321
4: 2768
Right 1090882932 11:130850078-130850100 TGTGGCTATGTTTGGAGATAGGG No data
1090882923_1090882929 6 Left 1090882923 11:130850041-130850063 CCCCCACAAATTCATGTGTTGAA 0: 3
1: 40
2: 326
3: 1321
4: 2768
Right 1090882929 11:130850070-130850092 ACTTCCAATGTGGCTATGTTTGG No data
1090882923_1090882931 13 Left 1090882923 11:130850041-130850063 CCCCCACAAATTCATGTGTTGAA 0: 3
1: 40
2: 326
3: 1321
4: 2768
Right 1090882931 11:130850077-130850099 ATGTGGCTATGTTTGGAGATAGG No data
1090882923_1090882933 26 Left 1090882923 11:130850041-130850063 CCCCCACAAATTCATGTGTTGAA 0: 3
1: 40
2: 326
3: 1321
4: 2768
Right 1090882933 11:130850090-130850112 TGGAGATAGGGCCTTTATGCAGG No data
1090882923_1090882927 -4 Left 1090882923 11:130850041-130850063 CCCCCACAAATTCATGTGTTGAA 0: 3
1: 40
2: 326
3: 1321
4: 2768
Right 1090882927 11:130850060-130850082 TGAACTCCTAACTTCCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090882923 Original CRISPR TTCAACACATGAATTTGTGG GGG (reversed) Intergenic
Too many off-targets to display for this crispr