ID: 1090882926

View in Genome Browser
Species Human (GRCh38)
Location 11:130850044-130850066
Sequence GAGTTCAACACATGAATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090882926_1090882929 3 Left 1090882926 11:130850044-130850066 CCACAAATTCATGTGTTGAACTC No data
Right 1090882929 11:130850070-130850092 ACTTCCAATGTGGCTATGTTTGG No data
1090882926_1090882927 -7 Left 1090882926 11:130850044-130850066 CCACAAATTCATGTGTTGAACTC No data
Right 1090882927 11:130850060-130850082 TGAACTCCTAACTTCCAATGTGG No data
1090882926_1090882932 11 Left 1090882926 11:130850044-130850066 CCACAAATTCATGTGTTGAACTC No data
Right 1090882932 11:130850078-130850100 TGTGGCTATGTTTGGAGATAGGG No data
1090882926_1090882931 10 Left 1090882926 11:130850044-130850066 CCACAAATTCATGTGTTGAACTC No data
Right 1090882931 11:130850077-130850099 ATGTGGCTATGTTTGGAGATAGG No data
1090882926_1090882933 23 Left 1090882926 11:130850044-130850066 CCACAAATTCATGTGTTGAACTC No data
Right 1090882933 11:130850090-130850112 TGGAGATAGGGCCTTTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090882926 Original CRISPR GAGTTCAACACATGAATTTG TGG (reversed) Intergenic
No off target data available for this crispr