ID: 1090882927

View in Genome Browser
Species Human (GRCh38)
Location 11:130850060-130850082
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090882923_1090882927 -4 Left 1090882923 11:130850041-130850063 CCCCCACAAATTCATGTGTTGAA 0: 3
1: 40
2: 326
3: 1321
4: 2768
Right 1090882927 11:130850060-130850082 TGAACTCCTAACTTCCAATGTGG No data
1090882924_1090882927 -5 Left 1090882924 11:130850042-130850064 CCCCACAAATTCATGTGTTGAAC No data
Right 1090882927 11:130850060-130850082 TGAACTCCTAACTTCCAATGTGG No data
1090882925_1090882927 -6 Left 1090882925 11:130850043-130850065 CCCACAAATTCATGTGTTGAACT No data
Right 1090882927 11:130850060-130850082 TGAACTCCTAACTTCCAATGTGG No data
1090882926_1090882927 -7 Left 1090882926 11:130850044-130850066 CCACAAATTCATGTGTTGAACTC No data
Right 1090882927 11:130850060-130850082 TGAACTCCTAACTTCCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090882927 Original CRISPR TGAACTCCTAACTTCCAATG TGG Intergenic
No off target data available for this crispr