ID: 1090883913

View in Genome Browser
Species Human (GRCh38)
Location 11:130859571-130859593
Sequence GAGTTAATCCACATAGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090883910_1090883913 12 Left 1090883910 11:130859536-130859558 CCTCATACTTCATGCAATCTTTG No data
Right 1090883913 11:130859571-130859593 GAGTTAATCCACATAGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090883913 Original CRISPR GAGTTAATCCACATAGAGCA CGG Intergenic
No off target data available for this crispr