ID: 1090888149

View in Genome Browser
Species Human (GRCh38)
Location 11:130897620-130897642
Sequence GGATTGGTGTGGAGTCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090888149_1090888153 -4 Left 1090888149 11:130897620-130897642 CCATCAGGACTCCACACCAATCC 0: 1
1: 0
2: 2
3: 9
4: 162
Right 1090888153 11:130897639-130897661 ATCCTACCCCTTACCTTGGCTGG 0: 1
1: 0
2: 1
3: 10
4: 75
1090888149_1090888151 -8 Left 1090888149 11:130897620-130897642 CCATCAGGACTCCACACCAATCC 0: 1
1: 0
2: 2
3: 9
4: 162
Right 1090888151 11:130897635-130897657 ACCAATCCTACCCCTTACCTTGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090888149 Original CRISPR GGATTGGTGTGGAGTCCTGA TGG (reversed) Intronic
900145149 1:1155994-1156016 GGAAGAGTGTGGGGTCCTGAAGG - Intergenic
901020481 1:6252753-6252775 GGATGGGCGTAGAGTCCTGCAGG + Intronic
901705771 1:11071886-11071908 AGATTGGTGGGGAGTGCTGGAGG - Intronic
902665824 1:17937281-17937303 GGATTGGAGGAGACTCCTGAAGG - Intergenic
912672644 1:111645403-111645425 GGATTGATGTGCAGTACTGAGGG + Intronic
914412712 1:147446957-147446979 TGCTTGCTGTGGAGTTCTGAAGG - Intergenic
915129272 1:153685940-153685962 GGACTGGTGGGGGGTTCTGAGGG + Intronic
915878871 1:159644035-159644057 GGACTGGTGTGAGGTCTTGAGGG - Intergenic
916419069 1:164619463-164619485 GGATCGGTGGGGAGTGCTCAAGG + Intronic
916932703 1:169595784-169595806 GGATTGGTGTGGATTTCATAAGG + Intronic
919977592 1:202623026-202623048 GGCTTGGTGGGGTGGCCTGAGGG - Intronic
920254462 1:204644972-204644994 AGATAGGTGTGGAATCCAGATGG - Intronic
920755484 1:208726965-208726987 GGATTGGTGGGCAATCCTGAGGG + Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
922764870 1:228151448-228151470 GGCCTGGTGGGGACTCCTGAGGG + Intronic
1066312583 10:34212194-34212216 GGATGGGGGAGGAGTCATGATGG - Intronic
1066778759 10:38919521-38919543 GGAGTGGAGTGGAGTGCTGTGGG + Intergenic
1067777952 10:49176626-49176648 GCATTGCTCTGGAGTCCTGAGGG + Intronic
1067972017 10:50982979-50983001 GGAGTGGTGTGAAGACCAGATGG - Intergenic
1074417602 10:113280843-113280865 GGGTTGGTAGGGAGTACTGAGGG + Intergenic
1074693578 10:116028377-116028399 GGAGAGGTGTGAAGTCCTGTGGG - Intergenic
1076001181 10:126914213-126914235 TGATTGCTGGGGGGTCCTGAAGG + Intronic
1079403120 11:20122308-20122330 GGCATGGTTTGGAGTCCTGTGGG + Intergenic
1080644148 11:34175920-34175942 GCATTGGAATGGAGTCTTGAAGG - Intronic
1083431099 11:62613806-62613828 GGATTGGTTTGGGGTCCAGTGGG + Exonic
1084490480 11:69475797-69475819 GGAATGTAGTTGAGTCCTGAGGG - Intergenic
1085319485 11:75565192-75565214 GGCTTGGGGAGGAGGCCTGAGGG + Intronic
1086206728 11:84267362-84267384 GGATAGGAGTTAAGTCCTGAAGG + Intronic
1086866589 11:91987022-91987044 GGATTGGGGTGGAGTGCAGTGGG - Intergenic
1087430169 11:98043740-98043762 GGATTGATGTGATGTTCTGAGGG + Intergenic
1088786654 11:113188336-113188358 AGATAGATGTGGAGTCCTGGGGG - Intronic
1089061829 11:115632117-115632139 GGTTTGATGTGGAGCCATGAAGG + Intergenic
1089129965 11:116203700-116203722 GGAGTGGTGTGGAGGTGTGAGGG + Intergenic
1089393203 11:118116032-118116054 GGATTGCTAAGCAGTCCTGATGG - Intronic
1090888149 11:130897620-130897642 GGATTGGTGTGGAGTCCTGATGG - Intronic
1092265552 12:6977827-6977849 GGATTGGATTGGAGTGCTGGTGG + Intronic
1094303230 12:28989557-28989579 GGATTGGAGGCGAGTCCTCAGGG - Intergenic
1096152977 12:49326003-49326025 GGGTTGGTGGTGAGGCCTGAGGG + Intronic
1097739702 12:63226476-63226498 GGAAGGGTGAGGAGTCCTCAAGG - Intergenic
1103699699 12:122842712-122842734 GGCCTGATGTGGAGTCCAGATGG - Intronic
1109156368 13:58915079-58915101 TGATTGATGTGGAGTCAAGAGGG + Intergenic
1113171205 13:107505241-107505263 GCATTGGTGAGGAATGCTGAAGG + Intronic
1116064558 14:39966424-39966446 TGATTGGTGTGGGGTTCAGAGGG + Intergenic
1119145328 14:72308324-72308346 GGATTTGAGTTGAGTCCTGAAGG - Intronic
1122278358 14:100606983-100607005 GGAGTGGTGAGGAGACCTAAGGG - Intergenic
1122488235 14:102095814-102095836 GAAATGGTGTGGGGCCCTGAGGG - Intronic
1126913134 15:53436070-53436092 GGATTGGTGAGGATTAATGAGGG + Intergenic
1128145421 15:65329997-65330019 AGATTGGTCTGGAGTCCTGTAGG - Intronic
1128267411 15:66278936-66278958 GCACTGGTGTTGAGTCCTTAGGG + Intergenic
1129361588 15:75027946-75027968 ACATTGGGGTTGAGTCCTGAAGG - Intronic
1132353379 15:101154454-101154476 GGGTTGGTGAGGAGTGCAGATGG + Intergenic
1132977236 16:2716847-2716869 GGATGGGTGTGGAGTGTGGAGGG - Intronic
1137554003 16:49458863-49458885 GTGGTGCTGTGGAGTCCTGAAGG + Intergenic
1140652372 16:77102319-77102341 GGATTTGAGTTGAGTCCTGTAGG - Intergenic
1141825055 16:86472923-86472945 GGATTGGAGAGGCGTCCCGAGGG + Intergenic
1143561288 17:7696784-7696806 GCACTGGTGTGGAGTCCAGGAGG + Intronic
1144325503 17:14175797-14175819 GGATTGGAGTTGAGAACTGAAGG + Intronic
1144373797 17:14618991-14619013 GGCATGGTGTGGAGTCTGGAGGG - Intergenic
1144474379 17:15572685-15572707 GGATTGGAGTTGAGAACTGAAGG + Exonic
1145707757 17:26938109-26938131 GGAGTGGAGTGGAGTGCTGTGGG + Intergenic
1146439191 17:32878494-32878516 GGATTGGGGTGGTTTTCTGATGG - Intergenic
1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG + Intronic
1203212776 17_KI270730v1_random:95648-95670 GGAGTGGAGTGGAGTGCTGTGGG + Intergenic
1154954075 18:21238669-21238691 GTATAAGTTTGGAGTCCTGAGGG - Intergenic
1163443564 19:17333879-17333901 GGAGTGGTGAGGAGCCCTGGCGG - Intronic
1167418460 19:49389484-49389506 GGTTCGGGATGGAGTCCTGAGGG - Intronic
933547202 2:83729690-83729712 GGCTAGGTGTGGAGGCCAGAAGG + Intergenic
933839723 2:86276619-86276641 AGATTGGTGTGCAGTCCTGGAGG + Intronic
933881302 2:86672739-86672761 GGAATGGTGTGGATTCCAGGTGG + Intronic
937064465 2:119006643-119006665 GGAGTGGAAGGGAGTCCTGAAGG + Intergenic
937098378 2:119250296-119250318 GGGGCGGTGTGGAGGCCTGAAGG + Intronic
937793110 2:125983528-125983550 GCATTTGTCTGGAGTCCTGGAGG - Intergenic
938675730 2:133632067-133632089 GGATTGGAGTGGAAGGCTGAAGG + Intergenic
938902819 2:135812471-135812493 GGATTCGTGTGGTGCCCTGGGGG - Exonic
939852948 2:147321531-147321553 GCATTGGGGTGGAGCCCTCATGG + Intergenic
940043732 2:149387627-149387649 GGATTGGGGTGGAGTTCTAGAGG + Intronic
943253558 2:185563983-185564005 GGGTTTGTGTGGAGTCCTTAGGG - Intergenic
946331163 2:219009892-219009914 GGATGGGTCTGGAGCTCTGATGG + Intronic
948547841 2:238745437-238745459 GAATTGGCGTGGGATCCTGAAGG - Intergenic
1171320784 20:24242318-24242340 GGATGGGGCTGGGGTCCTGAGGG - Intergenic
1171373796 20:24678236-24678258 GGATTGGTGCCGCTTCCTGAAGG - Intergenic
1172421781 20:34824941-34824963 GGATTGGGGTGGAGGCATGGGGG - Intronic
1172468043 20:35171804-35171826 GGCTTGGTGAGAAGTCCTGCCGG - Intergenic
1172633367 20:36393537-36393559 GGCTCGGTGTGGAGACCTCAGGG - Intronic
1173308444 20:41873943-41873965 GCATTTGTGCTGAGTCCTGAAGG - Intergenic
1175407800 20:58745983-58746005 GGGTGGGTGTGGCTTCCTGAAGG + Intergenic
1176033136 20:63023449-63023471 GCATTTGGGTGGTGTCCTGATGG + Intergenic
1181689226 22:24549128-24549150 GGATTTGAGGGGATTCCTGAAGG - Intronic
1182284171 22:29234227-29234249 GGAATTCTGGGGAGTCCTGAGGG + Intronic
1182943074 22:34296833-34296855 GCATTGGTGTGAGTTCCTGAGGG + Intergenic
1183648191 22:39138812-39138834 GGATTGGTGGGCAGGCCTGTGGG - Intronic
1184408679 22:44314160-44314182 GGTCTGGTGTGGACACCTGAAGG + Intergenic
1184466302 22:44670345-44670367 GGATTGCTGTGAAGTCCGGCAGG + Intronic
1203291460 22_KI270735v1_random:42651-42673 GGAGTGGAGTGGAGTACTGTGGG - Intergenic
950998277 3:17528272-17528294 GCATTAGGGTGAAGTCCTGATGG - Intronic
954198833 3:49012372-49012394 TGCTTGGTGTGGAGCCATGAAGG + Exonic
958063650 3:88514492-88514514 GGAGTTGTCTGGAGACCTGATGG - Intergenic
960081016 3:113540273-113540295 TGAGAGGTGTGGAGTCATGAGGG - Intronic
961378112 3:126480448-126480470 GGCTTGGTATGGAGCCCAGAGGG + Intergenic
961482441 3:127192842-127192864 GCATTGGGGAGGAGTCCTGCAGG - Intergenic
961616611 3:128187798-128187820 ACATTTGTGTGGAGTCCTCATGG + Intronic
962804160 3:138915399-138915421 GGATTAATGTCGAGCCCTGAAGG - Intergenic
965195295 3:165587093-165587115 GCATTGGAGTTGGGTCCTGAAGG - Intergenic
965465788 3:169029149-169029171 GCATTGCGGTGGACTCCTGAAGG - Intergenic
965477878 3:169179899-169179921 GGACTGATGGGGAGTCCTGGGGG - Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
968275209 3:197436258-197436280 GGGTTGGAGTGGAGCCCTGCTGG + Intergenic
968275219 3:197436301-197436323 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275240 3:197436387-197436409 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275274 3:197436559-197436581 GGATTAGAGTGGAGCCCTGCTGG + Intergenic
968275395 3:197437118-197437140 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275414 3:197437204-197437226 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275451 3:197437376-197437398 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275512 3:197437677-197437699 GGGTTGGAGTGGAGCCCTGCTGG + Intergenic
968275522 3:197437720-197437742 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275543 3:197437806-197437828 GGGTTGGAGTGGAGCCCTGCTGG + Intergenic
968275555 3:197437849-197437871 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275589 3:197438021-197438043 GGATTAGAGTGGAGCCCTGCTGG + Intergenic
969139692 4:5057627-5057649 GGATTTATGTTGAGTCTTGAGGG + Intronic
970111532 4:12643217-12643239 CTATTCCTGTGGAGTCCTGAGGG + Intergenic
970714944 4:18910969-18910991 GGGTTGGGGTGGAGTCTTTAGGG - Intergenic
973386245 4:49516080-49516102 GGCTTGGTGTGGAGCCCTCACGG - Intergenic
974318727 4:60315624-60315646 GGATTAGTAAGGAGGCCTGATGG + Intergenic
981049352 4:140295353-140295375 GGAGTGGTGGGGTGTGCTGATGG - Intronic
982465199 4:155721918-155721940 GGAAAGGGGTGGTGTCCTGAGGG + Intronic
982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG + Intronic
983577089 4:169271237-169271259 GGATTGGGGCGGCGGCCTGAGGG + Intergenic
990938274 5:61173751-61173773 GGATCAGTGTGGTGTTCTGAGGG - Intergenic
991734841 5:69622288-69622310 GGATTTGTGTGGAGTGGTGGAGG - Intergenic
991780137 5:70124430-70124452 GGATTTGTGTGGAGTGGTGGAGG + Intergenic
991811275 5:70477423-70477445 GGATTTGTGTGGAGTGGTGGAGG - Intergenic
991859424 5:70999859-70999881 GGATTTGTGTGGAGTGGTGGAGG + Intronic
991872584 5:71124753-71124775 GGATTTGTGTGGAGTGGTGGAGG + Intergenic
993652975 5:90544303-90544325 AGATAGGTGTGGTGTTCTGAGGG + Intronic
999873247 5:155773885-155773907 GGATGTGGGTGGAGACCTGAGGG + Intergenic
1003691165 6:8355029-8355051 GGATGGGTTTGGAGTTCAGAAGG + Intergenic
1004006955 6:11645794-11645816 GCACTGGTGGGGAGTCCAGAGGG + Intergenic
1005490630 6:26344077-26344099 GGTATGGTGAGGAGTCCAGATGG - Intergenic
1005532270 6:26720068-26720090 GGATAGGTGTGCAGGCATGATGG - Intergenic
1005538525 6:26781597-26781619 GGATAGGTGTGCAGGCATGATGG + Intergenic
1009009377 6:57823834-57823856 GGATAGGTGTGCAGGCATGATGG + Intergenic
1011920140 6:92564343-92564365 GGATTTTTGTGTAGTCCTCATGG - Intergenic
1013324969 6:109036028-109036050 AGAATGGTGGGGAGTCTTGAGGG - Intronic
1022543454 7:31161178-31161200 GGGTTGGTCTGGAATGCTGATGG + Intergenic
1022993176 7:35728278-35728300 GGGCTGGTGTGGAGTTGTGAAGG - Intergenic
1023959409 7:44914016-44914038 GGTTTGGCCTGGAGCCCTGAGGG + Intergenic
1024989897 7:55224935-55224957 GGATGGGTGTAGGGTACTGATGG - Intronic
1026072420 7:67133898-67133920 ATATTTGAGTGGAGTCCTGAAGG - Intronic
1026704479 7:72678340-72678362 ATATTTGAGTGGAGTCCTGAAGG + Intronic
1034921210 7:155084018-155084040 GGATAGGTGTGGGAACCTGAAGG - Intronic
1039512497 8:38103222-38103244 GAATTTGTGTGGAGGCATGATGG + Intergenic
1039853920 8:41396562-41396584 AGCTTGGTGTGGAGGCCTTAGGG + Intergenic
1040619827 8:49079067-49079089 GCTTTGGGGTGGAGTCCTGAAGG + Intergenic
1045355480 8:101384872-101384894 ACATTGGTTTGGATTCCTGAAGG - Intergenic
1047871649 8:129089548-129089570 GGATTGGTATGGAATCAAGAGGG + Intergenic
1049366654 8:142241119-142241141 GGTTTTGTGTGGAGTCCTTGGGG - Intronic
1049420361 8:142513721-142513743 GGCTTGAAGTGGGGTCCTGAGGG + Intronic
1051213132 9:14766593-14766615 GGATTCCTGTGGAGTCCTGAAGG - Intronic
1052571377 9:30228473-30228495 GAATTGGGGTAGAGTGCTGAAGG + Intergenic
1053458660 9:38251376-38251398 GAATTGCTGTGGAGTTCTTATGG - Intergenic
1055094463 9:72397308-72397330 GGATTTGAGTGCAGTCCGGAAGG + Intergenic
1057719087 9:97517984-97518006 GCAAGGGAGTGGAGTCCTGAGGG - Intronic
1062039356 9:134396945-134396967 GGAGGGGGCTGGAGTCCTGAGGG + Intronic
1062494893 9:136827025-136827047 GGGCTGGTGTGGAGGCCTGTGGG + Intronic
1186507079 X:10101883-10101905 GCATTGGAGTTGGGTCCTGAAGG + Intronic
1187968816 X:24639457-24639479 GCATTGGTGTGGAGTCCCAGAGG + Intronic
1188746272 X:33847878-33847900 GCATTGATGAGGAGTGCTGAGGG + Intergenic
1193066429 X:77265133-77265155 GGGCTGGTGTTGAGTGCTGATGG - Intergenic
1193450780 X:81662558-81662580 AGATTGGCTTGGAGTCCTTATGG + Intergenic
1196613775 X:117743675-117743697 GCCTGGGTGTGGAGTCCAGAGGG - Intergenic
1199272343 X:145898843-145898865 GGCTTGGTGTGGATCTCTGACGG - Intergenic
1200017818 X:153179646-153179668 GGATTGGAGTGCAGTCTTGGGGG - Intronic
1200216222 X:154369325-154369347 GGACTGGGGTGGGGGCCTGATGG - Intronic
1201106393 Y:10766560-10766582 GGAGTGGAGTGGAGTGCTGGGGG - Intergenic