ID: 1090892616

View in Genome Browser
Species Human (GRCh38)
Location 11:130939084-130939106
Sequence CCTGCTTTGCTGCCAGGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090892616_1090892620 -2 Left 1090892616 11:130939084-130939106 CCATACCCTGGCAGCAAAGCAGG No data
Right 1090892620 11:130939105-130939127 GGTTCTCTGCTTAGCACACCTGG No data
1090892616_1090892623 21 Left 1090892616 11:130939084-130939106 CCATACCCTGGCAGCAAAGCAGG No data
Right 1090892623 11:130939128-130939150 CCACCCTTAATCCTGTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090892616 Original CRISPR CCTGCTTTGCTGCCAGGGTA TGG (reversed) Intergenic
No off target data available for this crispr