ID: 1090897572

View in Genome Browser
Species Human (GRCh38)
Location 11:130992001-130992023
Sequence TCTGCCTCTCATGCTTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090897572_1090897574 -10 Left 1090897572 11:130992001-130992023 CCACAGAAAGCATGAGAGGCAGA No data
Right 1090897574 11:130992014-130992036 GAGAGGCAGACCAAAATTTAGGG No data
1090897572_1090897582 22 Left 1090897572 11:130992001-130992023 CCACAGAAAGCATGAGAGGCAGA No data
Right 1090897582 11:130992046-130992068 GGGGAGGTGCCATGACTCTCAGG No data
1090897572_1090897578 1 Left 1090897572 11:130992001-130992023 CCACAGAAAGCATGAGAGGCAGA No data
Right 1090897578 11:130992025-130992047 CAAAATTTAGGGAGCAGGGATGG No data
1090897572_1090897576 -3 Left 1090897572 11:130992001-130992023 CCACAGAAAGCATGAGAGGCAGA No data
Right 1090897576 11:130992021-130992043 AGACCAAAATTTAGGGAGCAGGG No data
1090897572_1090897583 23 Left 1090897572 11:130992001-130992023 CCACAGAAAGCATGAGAGGCAGA No data
Right 1090897583 11:130992047-130992069 GGGAGGTGCCATGACTCTCAGGG No data
1090897572_1090897575 -4 Left 1090897572 11:130992001-130992023 CCACAGAAAGCATGAGAGGCAGA No data
Right 1090897575 11:130992020-130992042 CAGACCAAAATTTAGGGAGCAGG No data
1090897572_1090897584 29 Left 1090897572 11:130992001-130992023 CCACAGAAAGCATGAGAGGCAGA No data
Right 1090897584 11:130992053-130992075 TGCCATGACTCTCAGGGCTCTGG No data
1090897572_1090897581 6 Left 1090897572 11:130992001-130992023 CCACAGAAAGCATGAGAGGCAGA No data
Right 1090897581 11:130992030-130992052 TTTAGGGAGCAGGGATGGGGAGG No data
1090897572_1090897580 3 Left 1090897572 11:130992001-130992023 CCACAGAAAGCATGAGAGGCAGA No data
Right 1090897580 11:130992027-130992049 AAATTTAGGGAGCAGGGATGGGG No data
1090897572_1090897579 2 Left 1090897572 11:130992001-130992023 CCACAGAAAGCATGAGAGGCAGA No data
Right 1090897579 11:130992026-130992048 AAAATTTAGGGAGCAGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090897572 Original CRISPR TCTGCCTCTCATGCTTTCTG TGG (reversed) Intergenic
No off target data available for this crispr